\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404713011:

Variant ID: vg0404713011 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4713011
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGGGGTGGGCGGGCGAGGCAAAGCACAATTTGATGCCCATGTCGTCATAATAGTCACCGAACAGCTCACTAGTGAACTGGGTGCCGTTATCTGTAATG[A/C]
TACGGTTGGGCACTCCGAATCGGGACGTGATGCCCCTGATGAACTTGAGGGCGGAATGCTTGTCGATCTTGACGACCGGGTATGCTTCGGGCCACTTGGT

Reverse complement sequence

ACCAAGTGGCCCGAAGCATACCCGGTCGTCAAGATCGACAAGCATTCCGCCCTCAAGTTCATCAGGGGCATCACGTCCCGATTCGGAGTGCCCAACCGTA[T/G]
CATTACAGATAACGGCACCCAGTTCACTAGTGAGCTGTTCGGTGACTATTATGACGACATGGGCATCAAATTGTGCTTTGCCTCGCCCGCCCACCCCAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.90% 3.10% 2.18% 2.81% NA
All Indica  2759 87.50% 4.50% 3.44% 4.53% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 93.30% 1.90% 2.60% 2.23% NA
Indica I  595 98.80% 0.50% 0.17% 0.50% NA
Indica II  465 60.60% 13.30% 12.69% 13.33% NA
Indica III  913 96.40% 1.30% 0.66% 1.64% NA
Indica Intermediate  786 84.50% 6.10% 3.69% 5.73% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 85.60% 11.10% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404713011 A -> C LOC_Os04g08680.1 missense_variant ; p.Ile396Ser; MODERATE nonsynonymous_codon ; I396S Average:60.427; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 probably damaging 2.055 DELETERIOUS 0.00
vg0404713011 A -> DEL LOC_Os04g08680.1 N frameshift_variant Average:60.427; most accessible tissue: Zhenshan97 flag leaf, score: 80.156 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404713011 NA 1.64E-07 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 NA 2.52E-09 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 NA 1.71E-08 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 NA 2.65E-07 mr1458 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 NA 2.28E-08 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 NA 1.66E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 NA 3.01E-10 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 NA 3.92E-06 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 NA 5.92E-08 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 NA 1.05E-08 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 NA 9.21E-08 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 NA 3.13E-06 mr1439_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 NA 9.60E-06 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 4.89E-06 7.02E-08 mr1895_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404713011 NA 7.06E-08 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251