Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404710616:

Variant ID: vg0404710616 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4710616
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.57, C: 0.43, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CACTGATTGCCTCAAGCGTCCTAGATGAAGCGCTGGGCGACATCCGCTTACAGTACGAGGTCCATGCCGAGGACTTGACGAAGAGGGTTAAGGACGCCCG[T/C]
GGTGTCCTCGATGCGGCTGCCGCCCAAGAGCAGCGCGAGTCCACCTTGGCTGCCCACGAGAGAATGGCGGCGGAGGCGGAGCCCTCCCTTCGCCTTCGTG

Reverse complement sequence

CACGAAGGCGAAGGGAGGGCTCCGCCTCCGCCGCCATTCTCTCGTGGGCAGCCAAGGTGGACTCGCGCTGCTCTTGGGCGGCAGCCGCATCGAGGACACC[A/G]
CGGGCGTCCTTAACCCTCTTCGTCAAGTCCTCGGCATGGACCTCGTACTGTAAGCGGATGTCGCCCAGCGCTTCATCTAGGACGCTTGAGGCAATCAGTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.50% 36.20% 0.21% 0.00% NA
All Indica  2759 92.00% 7.80% 0.22% 0.00% NA
All Japonica  1512 8.00% 91.90% 0.13% 0.00% NA
Aus  269 94.80% 5.20% 0.00% 0.00% NA
Indica I  595 98.70% 1.00% 0.34% 0.00% NA
Indica II  465 92.90% 7.10% 0.00% 0.00% NA
Indica III  913 86.20% 13.80% 0.00% 0.00% NA
Indica Intermediate  786 93.00% 6.50% 0.51% 0.00% NA
Temperate Japonica  767 0.70% 99.30% 0.00% 0.00% NA
Tropical Japonica  504 19.40% 80.20% 0.40% 0.00% NA
Japonica Intermediate  241 7.50% 92.50% 0.00% 0.00% NA
VI/Aromatic  96 40.60% 59.40% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404710616 T -> C LOC_Os04g08670.1 synonymous_variant ; p.Arg497Arg; LOW synonymous_codon Average:69.805; most accessible tissue: Zhenshan97 flag leaf, score: 85.388 N N N N
vg0404710616 T -> C LOC_Os04g08670.1 synonymous_variant ; p.Arg497Arg; LOW nonsynonymous_codon ; R497H Average:69.805; most accessible tissue: Zhenshan97 flag leaf, score: 85.388 unknown unknown DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0404710616 T C -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404710616 NA 2.00E-08 mr1514 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404710616 NA 1.11E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404710616 5.03E-06 4.95E-06 mr1060_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404710616 4.91E-07 4.91E-07 mr1439_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404710616 NA 5.13E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404710616 NA 6.78E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251