\
| Variant ID: vg0404710590 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4710590 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.53, C: 0.47, others allele: 0.00, population size: 88. )
GGAGACGGAGGAAGAGCGGCAGGCAGCACTGATTGCCTCAAGCGTCCTAGATGAAGCGCTGGGCGACATCCGCTTACAGTACGAGGTCCATGCCGAGGAC[T/C]
TGACGAAGAGGGTTAAGGACGCCCGTGGTGTCCTCGATGCGGCTGCCGCCCAAGAGCAGCGCGAGTCCACCTTGGCTGCCCACGAGAGAATGGCGGCGGA
TCCGCCGCCATTCTCTCGTGGGCAGCCAAGGTGGACTCGCGCTGCTCTTGGGCGGCAGCCGCATCGAGGACACCACGGGCGTCCTTAACCCTCTTCGTCA[A/G]
GTCCTCGGCATGGACCTCGTACTGTAAGCGGATGTCGCCCAGCGCTTCATCTAGGACGCTTGAGGCAATCAGTGCTGCCTGCCGCTCTTCCTCCGTCTCC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.50% | 36.30% | 0.17% | 0.04% | NA |
| All Indica | 2759 | 91.80% | 7.90% | 0.25% | 0.07% | NA |
| All Japonica | 1512 | 8.10% | 91.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 94.40% | 5.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 91.40% | 7.10% | 1.08% | 0.43% | NA |
| Indica III | 913 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 93.30% | 6.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.50% | 92.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 40.60% | 59.40% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 41.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404710590 | T -> C | LOC_Os04g08670.1 | synonymous_variant ; p.Leu489Leu; LOW | synonymous_codon | Average:70.902; most accessible tissue: Zhenshan97 flag leaf, score: 86.452 | N | N | N | N |
| vg0404710590 | T -> DEL | LOC_Os04g08670.1 | N | frameshift_variant | Average:70.902; most accessible tissue: Zhenshan97 flag leaf, score: 86.452 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404710590 | NA | 4.84E-08 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404710590 | NA | 6.35E-08 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404710590 | 6.70E-06 | NA | mr1060_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404710590 | 6.82E-06 | 6.82E-06 | mr1172_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404710590 | 2.84E-06 | NA | mr1439_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404710590 | 2.56E-06 | 2.56E-06 | mr1439_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404710590 | NA | 1.40E-08 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404710590 | NA | 6.10E-10 | mr1761_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |