Variant ID: vg0404658487 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 4658487 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 272. )
TGGAGGTTCTCTATTAGAATTCAGTAGTTAGGGGATCTTTTTCTTTTGTTGGTGTCTATTAGTTTGCTTAGCTTTGTTTCTGCTTTCGTGAACTTTCTGT[G/A]
TGAGTTCTGTAATAATTGGCTGTAACTCTTTGAGTAAAGGCCGGAATGTTACATTCCATTATCTAAAAAAAAACGTTGATAAAAAAGTCAATGGCGTTAT
ATAACGCCATTGACTTTTTTATCAACGTTTTTTTTTAGATAATGGAATGTAACATTCCGGCCTTTACTCAAAGAGTTACAGCCAATTATTACAGAACTCA[C/T]
ACAGAAAGTTCACGAAAGCAGAAACAAAGCTAAGCAAACTAATAGACACCAACAAAAGAAAAAGATCCCCTAACTACTGAATTCTAATAGAGAACCTCCA
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
All Indica | 2759 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
Aus | 269 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Indica III | 913 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 70.80% | 29.20% | 0.00% | 0.00% | NA |
Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0404658487 | G -> A | LOC_Os04g08570-LOC_Os04g08580 | intergenic_region ; MODIFIER | silent_mutation | Average:32.452; most accessible tissue: Callus, score: 55.433 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0404658487 | 2.44E-06 | 1.09E-09 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404658487 | NA | 3.06E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404658487 | NA | 4.59E-08 | mr1567_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404658487 | NA | 4.39E-07 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404658487 | 2.37E-07 | 2.90E-12 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404658487 | 5.86E-10 | 1.60E-19 | mr1842_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404658487 | 9.27E-07 | 2.60E-08 | mr1842_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404658487 | NA | 1.21E-07 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404658487 | NA | 1.09E-06 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |