Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404641755:

Variant ID: vg0404641755 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4641755
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTATGAAATTATTTTTCAAGACAAATCTATTCATATATTTTTTACATTTTTAAACTCAACAAATTGAGAGTTATTTATGATTTATATTTCTAAGGTTT[G/A]
ACTTAAGTATTGTCCTTAACGACTTACTTTATAAGTATGAAGAGAGTACAGTATAATTTACATATGCTTTAGCCTTAACTGCCCTACTCGTGGTTCCACC

Reverse complement sequence

GGTGGAACCACGAGTAGGGCAGTTAAGGCTAAAGCATATGTAAATTATACTGTACTCTCTTCATACTTATAAAGTAAGTCGTTAAGGACAATACTTAAGT[C/T]
AAACCTTAGAAATATAAATCATAAATAACTCTCAATTTGTTGAGTTTAAAAATGTAAAAAATATATGAATAGATTTGTCTTGAAAAATAATTTCATAAAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.70%	2.40%	1.35%	0.61%	NA
All Indica	2759	98.90%	0.00%	1.12%	0.00%	NA
All Japonica	1512	92.50%	7.40%	0.07%	0.00%	NA
Aus	269	78.10%	0.00%	11.15%	10.78%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	96.10%	0.00%	3.87%	0.00%	NA
Indica III	913	99.20%	0.00%	0.77%	0.00%	NA
Indica Intermediate	786	99.20%	0.00%	0.76%	0.00%	NA
Temperate Japonica	767	93.40%	6.60%	0.00%	0.00%	NA
Tropical Japonica	504	97.40%	2.40%	0.20%	0.00%	NA
Japonica Intermediate	241	79.70%	20.30%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404641755	G -> DEL	N	N	silent_mutation	Average:58.853; most accessible tissue: Callus, score: 75.141	N	N	N	N
vg0404641755	G -> A	LOC_Os04g08550.1	upstream_gene_variant ; 826.0bp to feature; MODIFIER	silent_mutation	Average:58.853; most accessible tissue: Callus, score: 75.141	N	N	N	N
vg0404641755	G -> A	LOC_Os04g08550-LOC_Os04g08570	intergenic_region ; MODIFIER	silent_mutation	Average:58.853; most accessible tissue: Callus, score: 75.141	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404641755	NA	4.35E-06	mr1057	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404641755	6.63E-06	6.63E-06	mr1716	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251