| Variant ID: vg0404607481 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4607481 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, A: 0.06, others allele: 0.00, population size: 209. )
TGAGGAGGGCTTTTGTGATTTTTCAAAGAATTAATCTTCGAACGGGCCATAGCCCATCTATTAATTCCAACAATCCCCCACCAAATCTCAAAATCCCACT[G/A]
AGATTTGCCTTTTCCAAAGTACTGTTTATATACCAGCGGTTCGATGGAGACCGATTAAGGTTGAACATCCATCTAGAACTCCAAGCTGCACTTACTCACA
TGTGAGTAAGTGCAGCTTGGAGTTCTAGATGGATGTTCAACCTTAATCGGTCTCCATCGAACCGCTGGTATATAAACAGTACTTTGGAAAAGGCAAATCT[C/T]
AGTGGGATTTTGAGATTTGGTGGGGGATTGTTGGAATTAATAGATGGGCTATGGCCCGTTCGAAGATTAATTCTTTGAAAAATCACAAAAGCCCTCCTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.90% | 15.90% | 1.14% | 0.00% | NA |
| All Indica | 2759 | 82.30% | 15.70% | 1.92% | 0.00% | NA |
| All Japonica | 1512 | 86.60% | 13.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 82.90% | 17.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 97.60% | 1.70% | 0.67% | 0.00% | NA |
| Indica II | 465 | 51.60% | 44.70% | 3.66% | 0.00% | NA |
| Indica III | 913 | 92.70% | 7.10% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 77.00% | 19.20% | 3.82% | 0.00% | NA |
| Temperate Japonica | 767 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 83.50% | 16.50% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.70% | 25.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 47.90% | 51.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 24.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404607481 | G -> A | LOC_Os04g08520.1 | downstream_gene_variant ; 771.0bp to feature; MODIFIER | silent_mutation | Average:23.212; most accessible tissue: Callus, score: 44.238 | N | N | N | N |
| vg0404607481 | G -> A | LOC_Os04g08510-LOC_Os04g08520 | intergenic_region ; MODIFIER | silent_mutation | Average:23.212; most accessible tissue: Callus, score: 44.238 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404607481 | NA | 4.29E-09 | mr1059 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607481 | NA | 3.82E-11 | mr1143 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607481 | NA | 5.73E-10 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607481 | NA | 1.11E-09 | mr1535 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607481 | NA | 2.02E-09 | mr1675 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607481 | NA | 2.17E-07 | mr1726 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607481 | 7.02E-09 | NA | mr1757 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607481 | NA | 1.75E-06 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607481 | NA | 9.16E-10 | mr1969 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607481 | NA | 1.04E-10 | mr1995 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/