\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404607386:

Variant ID: vg0404607386 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4607386
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.61, T: 0.39, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCAAGTGGCTAGGAGGGCATCCTCCCTTTTATGGAGGTCCCCCTCTCCTAGAATAAGCAAGGTGGTACTAAACTCCACATGCATGCCATCCCATGAGG[A/T]
GGGCTTTTGTGATTTTTCAAAGAATTAATCTTCGAACGGGCCATAGCCCATCTATTAATTCCAACAATCCCCCACCAAATCTCAAAATCCCACTGAGATT

Reverse complement sequence

AATCTCAGTGGGATTTTGAGATTTGGTGGGGGATTGTTGGAATTAATAGATGGGCTATGGCCCGTTCGAAGATTAATTCTTTGAAAAATCACAAAAGCCC[T/A]
CCTCATGGGATGGCATGCATGTGGAGTTTAGTACCACCTTGCTTATTCTAGGAGAGGGGGACCTCCATAAAAGGGAGGATGCCCTCCTAGCCACTTGAAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.80% 20.60% 5.69% 1.88% NA
All Indica  2759 89.60% 1.60% 6.56% 2.17% NA
All Japonica  1512 37.00% 59.70% 3.11% 0.13% NA
Aus  269 75.50% 1.50% 13.75% 9.29% NA
Indica I  595 98.30% 0.50% 1.18% 0.00% NA
Indica II  465 71.20% 3.20% 18.71% 6.88% NA
Indica III  913 96.50% 1.00% 1.31% 1.20% NA
Indica Intermediate  786 86.00% 2.30% 9.54% 2.16% NA
Temperate Japonica  767 9.50% 90.10% 0.39% 0.00% NA
Tropical Japonica  504 74.80% 17.90% 6.94% 0.40% NA
Japonica Intermediate  241 45.60% 50.60% 3.73% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 0.00% 1.04% NA
Intermediate  90 73.30% 21.10% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404607386 A -> DEL N N silent_mutation Average:29.137; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N
vg0404607386 A -> T LOC_Os04g08520.1 downstream_gene_variant ; 866.0bp to feature; MODIFIER silent_mutation Average:29.137; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N
vg0404607386 A -> T LOC_Os04g08510-LOC_Os04g08520 intergenic_region ; MODIFIER silent_mutation Average:29.137; most accessible tissue: Zhenshan97 root, score: 41.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404607386 NA 5.69E-12 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386 NA 2.86E-10 mr1282 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386 NA 6.98E-12 mr1650 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386 1.32E-06 7.10E-24 mr1698 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386 3.38E-06 1.13E-06 mr1698 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386 6.35E-06 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386 NA 1.00E-05 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386 NA 5.24E-06 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386 NA 3.81E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251