\
| Variant ID: vg0404607386 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4607386 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.61, T: 0.39, others allele: 0.00, population size: 93. )
CTTCAAGTGGCTAGGAGGGCATCCTCCCTTTTATGGAGGTCCCCCTCTCCTAGAATAAGCAAGGTGGTACTAAACTCCACATGCATGCCATCCCATGAGG[A/T]
GGGCTTTTGTGATTTTTCAAAGAATTAATCTTCGAACGGGCCATAGCCCATCTATTAATTCCAACAATCCCCCACCAAATCTCAAAATCCCACTGAGATT
AATCTCAGTGGGATTTTGAGATTTGGTGGGGGATTGTTGGAATTAATAGATGGGCTATGGCCCGTTCGAAGATTAATTCTTTGAAAAATCACAAAAGCCC[T/A]
CCTCATGGGATGGCATGCATGTGGAGTTTAGTACCACCTTGCTTATTCTAGGAGAGGGGGACCTCCATAAAAGGGAGGATGCCCTCCTAGCCACTTGAAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.80% | 20.60% | 5.69% | 1.88% | NA |
| All Indica | 2759 | 89.60% | 1.60% | 6.56% | 2.17% | NA |
| All Japonica | 1512 | 37.00% | 59.70% | 3.11% | 0.13% | NA |
| Aus | 269 | 75.50% | 1.50% | 13.75% | 9.29% | NA |
| Indica I | 595 | 98.30% | 0.50% | 1.18% | 0.00% | NA |
| Indica II | 465 | 71.20% | 3.20% | 18.71% | 6.88% | NA |
| Indica III | 913 | 96.50% | 1.00% | 1.31% | 1.20% | NA |
| Indica Intermediate | 786 | 86.00% | 2.30% | 9.54% | 2.16% | NA |
| Temperate Japonica | 767 | 9.50% | 90.10% | 0.39% | 0.00% | NA |
| Tropical Japonica | 504 | 74.80% | 17.90% | 6.94% | 0.40% | NA |
| Japonica Intermediate | 241 | 45.60% | 50.60% | 3.73% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 3.10% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 73.30% | 21.10% | 4.44% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404607386 | A -> DEL | N | N | silent_mutation | Average:29.137; most accessible tissue: Zhenshan97 root, score: 41.416 | N | N | N | N |
| vg0404607386 | A -> T | LOC_Os04g08520.1 | downstream_gene_variant ; 866.0bp to feature; MODIFIER | silent_mutation | Average:29.137; most accessible tissue: Zhenshan97 root, score: 41.416 | N | N | N | N |
| vg0404607386 | A -> T | LOC_Os04g08510-LOC_Os04g08520 | intergenic_region ; MODIFIER | silent_mutation | Average:29.137; most accessible tissue: Zhenshan97 root, score: 41.416 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404607386 | NA | 5.69E-12 | mr1182 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607386 | NA | 2.86E-10 | mr1282 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607386 | NA | 6.98E-12 | mr1650 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607386 | 1.32E-06 | 7.10E-24 | mr1698 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607386 | 3.38E-06 | 1.13E-06 | mr1698 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607386 | 6.35E-06 | NA | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607386 | NA | 1.00E-05 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607386 | NA | 5.24E-06 | mr1977 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404607386 | NA | 3.81E-06 | mr1763_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |