Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404607386:

Variant ID: vg0404607386 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4607386
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.61, T: 0.39, others allele: 0.00, population size: 93. )

Flanking Sequence (100 bp) in Reference Genome:

CTTCAAGTGGCTAGGAGGGCATCCTCCCTTTTATGGAGGTCCCCCTCTCCTAGAATAAGCAAGGTGGTACTAAACTCCACATGCATGCCATCCCATGAGG[A/T]
GGGCTTTTGTGATTTTTCAAAGAATTAATCTTCGAACGGGCCATAGCCCATCTATTAATTCCAACAATCCCCCACCAAATCTCAAAATCCCACTGAGATT

Reverse complement sequence

AATCTCAGTGGGATTTTGAGATTTGGTGGGGGATTGTTGGAATTAATAGATGGGCTATGGCCCGTTCGAAGATTAATTCTTTGAAAAATCACAAAAGCCC[T/A]
CCTCATGGGATGGCATGCATGTGGAGTTTAGTACCACCTTGCTTATTCTAGGAGAGGGGGACCTCCATAAAAGGGAGGATGCCCTCCTAGCCACTTGAAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.80%	20.60%	5.69%	1.88%	NA
All Indica	2759	89.60%	1.60%	6.56%	2.17%	NA
All Japonica	1512	37.00%	59.70%	3.11%	0.13%	NA
Aus	269	75.50%	1.50%	13.75%	9.29%	NA
Indica I	595	98.30%	0.50%	1.18%	0.00%	NA
Indica II	465	71.20%	3.20%	18.71%	6.88%	NA
Indica III	913	96.50%	1.00%	1.31%	1.20%	NA
Indica Intermediate	786	86.00%	2.30%	9.54%	2.16%	NA
Temperate Japonica	767	9.50%	90.10%	0.39%	0.00%	NA
Tropical Japonica	504	74.80%	17.90%	6.94%	0.40%	NA
Japonica Intermediate	241	45.60%	50.60%	3.73%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	0.00%	1.04%	NA
Intermediate	90	73.30%	21.10%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404607386	A -> DEL	N	N	silent_mutation	Average:29.137; most accessible tissue: Zhenshan97 root, score: 41.416	N	N	N	N
vg0404607386	A -> T	LOC_Os04g08520.1	downstream_gene_variant ; 866.0bp to feature; MODIFIER	silent_mutation	Average:29.137; most accessible tissue: Zhenshan97 root, score: 41.416	N	N	N	N
vg0404607386	A -> T	LOC_Os04g08510-LOC_Os04g08520	intergenic_region ; MODIFIER	silent_mutation	Average:29.137; most accessible tissue: Zhenshan97 root, score: 41.416	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404607386	NA	5.69E-12	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386	NA	2.86E-10	mr1282	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386	NA	6.98E-12	mr1650	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386	1.32E-06	7.10E-24	mr1698	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386	3.38E-06	1.13E-06	mr1698	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386	6.35E-06	NA	mr1757	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386	NA	1.00E-05	mr1837	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386	NA	5.24E-06	mr1977	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404607386	NA	3.81E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251