RiceVarMap2

Detailed information for vg0404582911:

Variant ID: vg0404582911 (JBrowse)

Variation Type: SNP

Chromosome: chr04

Position: 4582911

Reference Allele: C

Alternative Allele: T

Primary Allele: C

Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CAAAGTTATATAGACAAATGACCAAAATAAAAGTTGTATATCTTGATGAGAGGATCAACTTTTTTGTTGACCATATTTCCATTTGAAATCATTTAGTATC[C/T]
GAAAATGTATTATGACTAATAAAATGAATTATTACACAACAGCTATATATTTTGTACGCACAAATATAAAGACTTGTTTGGAAAAATGGGAAAATAGTCA

Reverse complement sequence

TGACTATTTTCCCATTTTTCCAAACAAGTCTTTATATTTGTGCGTACAAAATATATAGCTGTTGTGTAATAATTCATTTTATTAGTCATAATACATTTTC[G/A]
GATACTAAATGATTTCAAATGGAAATATGGTCAACAAAAAAGTTGATCCTCTCATCAAGATATACAACTTTTATTTTGGTCATTTGTCTATATAACTTTG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	95.20%	4.70%	0.17%	0.00%	NA
All Indica	2759	98.00%	1.70%	0.29%	0.00%	NA
All Japonica	1512	92.20%	7.80%	0.00%	0.00%	NA
Aus	269	99.30%	0.70%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	99.10%	0.40%	0.43%	0.00%	NA
Indica III	913	95.80%	3.60%	0.55%	0.00%	NA
Indica Intermediate	786	98.60%	1.40%	0.00%	0.00%	NA
Temperate Japonica	767	94.50%	5.50%	0.00%	0.00%	NA
Tropical Japonica	504	85.90%	14.10%	0.00%	0.00%	NA
Japonica Intermediate	241	97.90%	2.10%	0.00%	0.00%	NA
VI/Aromatic	96	49.00%	51.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404582911	C -> T	LOC_Os04g08480.1	upstream_gene_variant ; 3344.0bp to feature; MODIFIER	silent_mutation	Average:19.53; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N
vg0404582911	C -> T	LOC_Os04g08480-LOC_Os04g08500	intergenic_region ; MODIFIER	silent_mutation	Average:19.53; most accessible tissue: Minghui63 panicle, score: 42.799	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404582911	2.50E-06	NA	mr1549	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404582911	3.77E-07	NA	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404582911	1.65E-06	3.06E-06	mr1549_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 3 of 3 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0404582911:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact