Variant ID: vg0404570369 (JBrowse) | Variation Type: SNP |
Chromosome: chr04 | Position: 4570369 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GACTCGTACGAGACGGTGCGAAGTTCTATTGATAGAGCAGGAAAAAATTACAAGATTACAACCCTGGCGGATCGTAACCAGGAAAAATGAAAAAATATAG[C/T]
ACCACCCGCACACCGACAGCGCCAACACACAACCCGGGAGAAGGCTAGCACCGAACCGACTGCCGCTAGACCAACAAAGGAACACAGACAACATTGCCCC
GGGGCAATGTTGTCTGTGTTCCTTTGTTGGTCTAGCGGCAGTCGGTTCGGTGCTAGCCTTCTCCCGGGTTGTGTGTTGGCGCTGTCGGTGTGCGGGTGGT[G/A]
CTATATTTTTTCATTTTTCCTGGTTACGATCCGCCAGGGTTGTAATCTTGTAATTTTTTCCTGCTCTATCAATAGAACTTCGCACCGTCTCGTACGAGTC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 93.90% | 6.10% | 0.00% | 0.00% | NA |
All Indica | 2759 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 85.10% | 14.90% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 78.40% | 21.60% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0404570369 | C -> T | LOC_Os04g08480.1 | downstream_gene_variant ; 4113.0bp to feature; MODIFIER | silent_mutation | Average:54.128; most accessible tissue: Zhenshan97 flower, score: 66.841 | N | N | N | N |
vg0404570369 | C -> T | LOC_Os04g08470.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.128; most accessible tissue: Zhenshan97 flower, score: 66.841 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0404570369 | NA | 5.66E-06 | mr1057 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404570369 | NA | 2.73E-06 | mr1123 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404570369 | NA | 1.86E-06 | mr1118_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404570369 | NA | 9.06E-06 | mr1119_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404570369 | NA | 3.28E-06 | mr1120_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404570369 | NA | 3.91E-07 | mr1123_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404570369 | NA | 1.25E-07 | mr1240_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404570369 | NA | 5.68E-06 | mr1242_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404570369 | NA | 4.67E-06 | mr1247_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0404570369 | NA | 5.60E-06 | mr1496_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |