| Variant ID: vg0404541420 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4541420 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GAGAGGACCAGACTCGTAGATGATGGGGAAATCCGACCGCTCCCACCCGTCCGCCTGCACGTCCTGATAGTGTGGTGGGCGAAGGAGCGAGAAACTCACA[T/C]
GAAGACAAAGAAAACAGATGGCGGGTGCTTGTGCTTGCCACTAGCGGCAGCCTTCTTCCGCTTCCTAGAGCCGCCGGCAGCCTTGAGCCTACAAGGCTAG
CTAGCCTTGTAGGCTCAAGGCTGCCGGCGGCTCTAGGAAGCGGAAGAAGGCTGCCGCTAGTGGCAAGCACAAGCACCCGCCATCTGTTTTCTTTGTCTTC[A/G]
TGTGAGTTTCTCGCTCCTTCGCCCACCACACTATCAGGACGTGCAGGCGGACGGGTGGGAGCGGTCGGATTTCCCCATCATCTACGAGTCTGGTCCTCTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 69.10% | 30.90% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 81.80% | 18.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 51.00% | 49.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 45.40% | 54.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 68.90% | 31.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 78.80% | 21.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 6.20% | 93.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 26.60% | 73.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 50.00% | 49.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404541420 | T -> C | LOC_Os04g08440.1 | upstream_gene_variant ; 2204.0bp to feature; MODIFIER | silent_mutation | Average:72.535; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0404541420 | T -> C | LOC_Os04g08450.3 | upstream_gene_variant ; 2197.0bp to feature; MODIFIER | silent_mutation | Average:72.535; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0404541420 | T -> C | LOC_Os04g08450.1 | upstream_gene_variant ; 2197.0bp to feature; MODIFIER | silent_mutation | Average:72.535; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0404541420 | T -> C | LOC_Os04g08450.2 | upstream_gene_variant ; 2197.0bp to feature; MODIFIER | silent_mutation | Average:72.535; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0404541420 | T -> C | LOC_Os04g08440-LOC_Os04g08450 | intergenic_region ; MODIFIER | silent_mutation | Average:72.535; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404541420 | NA | 2.59E-07 | mr1176 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404541420 | NA | 1.75E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404541420 | NA | 1.69E-08 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404541420 | NA | 3.09E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404541420 | NA | 6.99E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404541420 | NA | 1.51E-09 | mr1880 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404541420 | NA | 3.41E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404541420 | NA | 8.33E-06 | mr1977 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404541420 | 3.35E-07 | NA | mr1033_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404541420 | NA | 5.09E-09 | mr1458_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404541420 | NA | 3.14E-10 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404541420 | NA | 3.18E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |