\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404540486:

Variant ID: vg0404540486 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4540486
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


GTCATGATACTCTCGGTCCTATGTCACCGACAATAGTATTAGAATGTGTCACATCTCAATAAAATCTTCTTGTATTTTGGGATGGTGGAGTATAGTACAG[G/A]
CGAGGAAGCCACTGAATCTTGTGACCACAAAAAAAAAATTGAAGGAAAGGGACGGAGAAAACAAGGATAATTTGATCGAGGTGGTAAATATCTGATGTCT

Reverse complement sequence

AGACATCAGATATTTACCACCTCGATCAAATTATCCTTGTTTTCTCCGTCCCTTTCCTTCAATTTTTTTTTTGTGGTCACAAGATTCAGTGGCTTCCTCG[C/T]
CTGTACTATACTCCACCATCCCAAAATACAAGAAGATTTTATTGAGATGTGACACATTCTAATACTATTGTCGGTGACATAGGACCGAGAGTATCATGAC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 9.80% 0.30% 0.59% NA
All Indica  2759 85.00% 14.70% 0.36% 0.00% NA
All Japonica  1512 96.90% 1.10% 0.20% 1.85% NA
Aus  269 91.80% 7.80% 0.37% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 59.10% 40.90% 0.00% 0.00% NA
Indica III  913 91.30% 8.10% 0.55% 0.00% NA
Indica Intermediate  786 82.30% 17.00% 0.64% 0.00% NA
Temperate Japonica  767 94.40% 1.70% 0.26% 3.65% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.30% 1.20% 0.41% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404540486 G -> DEL N N silent_mutation Average:67.217; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0404540486 G -> A LOC_Os04g08440.1 upstream_gene_variant ; 1270.0bp to feature; MODIFIER silent_mutation Average:67.217; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0404540486 G -> A LOC_Os04g08450.3 upstream_gene_variant ; 3131.0bp to feature; MODIFIER silent_mutation Average:67.217; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0404540486 G -> A LOC_Os04g08450.1 upstream_gene_variant ; 3131.0bp to feature; MODIFIER silent_mutation Average:67.217; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0404540486 G -> A LOC_Os04g08450.2 upstream_gene_variant ; 3131.0bp to feature; MODIFIER silent_mutation Average:67.217; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N
vg0404540486 G -> A LOC_Os04g08440-LOC_Os04g08450 intergenic_region ; MODIFIER silent_mutation Average:67.217; most accessible tissue: Zhenshan97 flag leaf, score: 91.333 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0404540486 G A -0.01 0.0 0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404540486 NA 1.09E-08 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 6.75E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 8.48E-11 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 1.54E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 1.44E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 9.08E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 1.76E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 1.38E-07 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 4.34E-07 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 5.16E-07 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 1.69E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 3.97E-10 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 2.00E-11 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 2.95E-10 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 1.22E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 2.93E-06 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 3.33E-09 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 3.74E-06 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 1.18E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 2.46E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 5.25E-07 mr1829_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 1.81E-08 9.62E-11 mr1842_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404540486 NA 6.43E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251