\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404490479:

Variant ID: vg0404490479 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4490479
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


ATTAGGAACTTAGCCTATCAAACAACCTAATGTGAAATTCACTCATATAAAGATTTAAACTCAGAACCTTAGAGTGCTACTTAGGTCACTACAACCATTA[G/A]
TCTACATATCCGTTTTGCAAGAGCTCGATCGATGACTCATCGATATATACATATGGCTCCAACGTGAATTCATTACATCCAAAGCCGATAATCTACTCAG

Reverse complement sequence

CTGAGTAGATTATCGGCTTTGGATGTAATGAATTCACGTTGGAGCCATATGTATATATCGATGAGTCATCGATCGAGCTCTTGCAAAACGGATATGTAGA[C/T]
TAATGGTTGTAGTGACCTAAGTAGCACTCTAAGGTTCTGAGTTTAAATCTTTATATGAGTGAATTTCACATTAGGTTGTTTGATAGGCTAAGTTCCTAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.70% 10.20% 0.42% 4.66% NA
All Indica  2759 81.00% 16.20% 0.29% 2.43% NA
All Japonica  1512 89.10% 1.50% 0.60% 8.86% NA
Aus  269 94.40% 0.00% 0.37% 5.20% NA
Indica I  595 96.00% 2.00% 0.34% 1.68% NA
Indica II  465 95.70% 4.30% 0.00% 0.00% NA
Indica III  913 62.50% 34.70% 0.11% 2.63% NA
Indica Intermediate  786 82.60% 12.60% 0.64% 4.20% NA
Temperate Japonica  767 97.00% 0.00% 0.13% 2.87% NA
Tropical Japonica  504 80.40% 4.20% 1.39% 14.09% NA
Japonica Intermediate  241 82.20% 0.40% 0.41% 17.01% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 84.40% 7.80% 2.22% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404490479 G -> DEL N N silent_mutation Average:78.223; most accessible tissue: Minghui63 flag leaf, score: 98.512 N N N N
vg0404490479 G -> A LOC_Os04g08390.1 upstream_gene_variant ; 378.0bp to feature; MODIFIER silent_mutation Average:78.223; most accessible tissue: Minghui63 flag leaf, score: 98.512 N N N N
vg0404490479 G -> A LOC_Os04g08390-LOC_Os04g08400 intergenic_region ; MODIFIER silent_mutation Average:78.223; most accessible tissue: Minghui63 flag leaf, score: 98.512 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0404490479 G A -0.08 -0.05 -0.03 -0.04 -0.05 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404490479 NA 2.83E-06 mr1020 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404490479 NA 4.73E-06 mr1032 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404490479 NA 3.16E-06 mr1042 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404490479 NA 9.57E-06 mr1477 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404490479 NA 5.42E-06 mr1478 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404490479 NA 5.22E-06 mr1912 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404490479 5.07E-07 4.45E-09 mr1971 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404490479 NA 4.88E-06 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404490479 NA 6.18E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404490479 NA 6.02E-07 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251