\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404471156:

Variant ID: vg0404471156 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 4471156
Reference Allele: CGAGGAlternative Allele: CAAACGGAGG,TGAGG,CAGG,C,CAATAGAGG,GGAGG
Primary Allele: CGAGGSecondary Allele: CAAACGGAGG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGTGAGTCTGATGTAGGCCATGATAGTGGAAGCACAAACGTGAGCCTCGGACAGTAGTGTAAGTGTATACTCCTCAGTTTTGCAAAGGAACTATCGTCC[CGAGG/CAAACGGAGG,TGAGG,CAGG,C,CAATAGAGG,GGAGG]
ACTGGCTGTCCTTCCTCTGCTCCAAATACAATTTGCCATCATGAGCTCAGCTGCTGAAAATGCCTCCAGTGTTTCAAAGCAGTATTTAGTATAATCGGTA

Reverse complement sequence

TACCGATTATACTAAATACTGCTTTGAAACACTGGAGGCATTTTCAGCAGCTGAGCTCATGATGGCAAATTGTATTTGGAGCAGAGGAAGGACAGCCAGT[CCTCG/CCTCCGTTTG,CCTCA,CCTG,G,CCTCTATTG,CCTCC]
GGACGATAGTTCCTTTGCAAAACTGAGGAGTATACACTTACACTACTGTCCGAGGCTCACGTTTGTGCTTCCACTATCATGGCCTACATCAGACTCACAC

Allele Frequencies:

Populations Population SizeFrequency of CGAGG(primary allele) Frequency of CAAACGGAGG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.80% 9.90% 12.10% 13.44% TGAGG: 8.32%; CAGG: 2.56%; GGAGG: 1.67%; CAATAGAGG: 1.33%; C: 0.89%
All Indica  2759 40.20% 6.90% 16.35% 16.82% TGAGG: 13.37%; CAGG: 3.99%; CAATAGAGG: 2.17%; GGAGG: 0.14%; C: 0.04%
All Japonica  1512 73.10% 6.90% 2.12% 10.25% GGAGG: 4.89%; C: 1.72%; TGAGG: 0.53%; CAGG: 0.46%; CAATAGAGG: 0.07%
Aus  269 22.30% 51.70% 23.79% 1.86% C: 0.37%
Indica I  595 45.50% 4.50% 37.31% 2.02% CAGG: 8.24%; TGAGG: 2.35%
Indica II  465 21.10% 1.10% 6.24% 28.82% TGAGG: 41.29%; CAGG: 1.51%
Indica III  913 51.30% 8.80% 9.53% 18.73% CAATAGAGG: 5.81%; TGAGG: 3.07%; CAGG: 2.74%; GGAGG: 0.11%
Indica Intermediate  786 34.70% 9.90% 14.38% 18.70% TGAGG: 17.18%; CAGG: 3.69%; CAATAGAGG: 0.89%; GGAGG: 0.38%; C: 0.13%
Temperate Japonica  767 76.90% 0.00% 3.26% 15.51% C: 2.48%; GGAGG: 1.04%; TGAGG: 0.78%
Tropical Japonica  504 71.20% 19.20% 0.20% 4.17% GGAGG: 2.98%; CAGG: 1.39%; C: 0.40%; TGAGG: 0.20%; CAATAGAGG: 0.20%
Japonica Intermediate  241 64.70% 2.90% 2.49% 6.22% GGAGG: 21.16%; C: 2.07%; TGAGG: 0.41%
VI/Aromatic  96 43.80% 19.80% 17.71% 0.00% C: 14.58%; TGAGG: 3.12%; GGAGG: 1.04%
Intermediate  90 42.20% 15.60% 8.89% 12.22% TGAGG: 14.44%; CAGG: 4.44%; CAATAGAGG: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404471156 CGAGG -> DEL LOC_Os04g08370.1 N frameshift_variant Average:73.291; most accessible tissue: Minghui63 flag leaf, score: 98.394 N N N N
vg0404471156 CGAGG -> GGAGG LOC_Os04g08370.1 N nonsynonymous_codon ; R786P Average:73.291; most accessible tissue: Minghui63 flag leaf, score: 98.394 possibly damaging +1.590 N N
vg0404471156 CGAGG -> CAATAGAGG LOC_Os04g08370.1 frameshift_variant ; p.Arg786fs; HIGH frameshift_variant Average:73.291; most accessible tissue: Minghui63 flag leaf, score: 98.394 N N N N
vg0404471156 CGAGG -> C LOC_Os04g08370.1 frameshift_variant ; p.Pro785fs; HIGH frameshift_variant Average:73.291; most accessible tissue: Minghui63 flag leaf, score: 98.394 N N N N
vg0404471156 CGAGG -> CAAACGGAGG LOC_Os04g08370.1 frameshift_variant ; p.Arg786fs; HIGH frameshift_variant Average:73.291; most accessible tissue: Minghui63 flag leaf, score: 98.394 N N N N
vg0404471156 CGAGG -> CAGG LOC_Os04g08370.1 frameshift_variant ; p.Arg786fs; HIGH frameshift_variant Average:73.291; most accessible tissue: Minghui63 flag leaf, score: 98.394 N N N N
vg0404471156 CGAGG -> TGAGG LOC_Os04g08370.1 missense_variant ; p.Arg786Gln; MODERATE nonsynonymous_codon ; R786Q Average:73.291; most accessible tissue: Minghui63 flag leaf, score: 98.394 benign +0.107 N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0404471156 CGAGG C -0.42 -0.09 -0.09 -0.1 -0.1 -0.1
vg0404471156 CGAGG CAAAC* -0.68 -0.12 -0.07 -0.11 -0.19 -0.16
vg0404471156 CGAGG CAATA* -0.26 -0.01 0.0 0.02 0.0 0.01
vg0404471156 CGAGG CAGG -0.49 -0.04 -0.02 -0.05 -0.1 -0.09
vg0404471156 CGAGG GGAGG 0.03 0.0 0.0 -0.01 -0.01 -0.02
vg0404471156 CGAGG TGAGG 0.1 0.01 0.0 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404471156 NA 2.22E-06 mr1830 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404471156 NA 1.95E-07 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404471156 NA 1.55E-08 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404471156 NA 5.33E-06 mr1457_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404471156 NA 3.09E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404471156 NA 9.59E-07 mr1698_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404471156 NA 4.88E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404471156 NA 7.95E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404471156 1.40E-06 1.36E-08 mr1950_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251