Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404456120:

Variant ID: vg0404456120 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4456120
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCTTTTCTGCCTTGTAACCTAAGACTTTGGTTTCATTGTTCACCTTATAGATATCTCTGTACGTGTTCTGTAGTTATCTTTAACAAGTAGCCAATGCT[T/C]
TAAAGGCTTCTTCAAGAATATGATATAAAAAAGGTGGATATACTATTCCCGTCGACTTTGTTCTATATATGATATCACGGTAAATATTTTTGCTTCTGTT

Reverse complement sequence

AACAGAAGCAAAAATATTTACCGTGATATCATATATAGAACAAAGTCGACGGGAATAGTATATCCACCTTTTTTATATCATATTCTTGAAGAAGCCTTTA[A/G]
AGCATTGGCTACTTGTTAAAGATAACTACAGAACACGTACAGAGATATCTATAAGGTGAACAATGAAACCAAAGTCTTAGGTTACAAGGCAGAAAAGAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 11.00% 0.08% 0.00% NA
All Indica  2759 81.60% 18.40% 0.04% 0.00% NA
All Japonica  1512 99.70% 0.30% 0.00% 0.00% NA
Aus  269 97.80% 1.90% 0.37% 0.00% NA
Indica I  595 98.20% 1.80% 0.00% 0.00% NA
Indica II  465 92.90% 7.10% 0.00% 0.00% NA
Indica III  913 65.10% 34.80% 0.11% 0.00% NA
Indica Intermediate  786 81.40% 18.60% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 5.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404456120 T -> C LOC_Os04g08340.1 downstream_gene_variant ; 770.0bp to feature; MODIFIER silent_mutation Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0404456120 T -> C LOC_Os04g08350.1 downstream_gene_variant ; 1338.0bp to feature; MODIFIER silent_mutation Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0404456120 T -> C LOC_Os04g08350.2 downstream_gene_variant ; 1280.0bp to feature; MODIFIER silent_mutation Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0404456120 T -> C LOC_Os04g08350.4 downstream_gene_variant ; 2181.0bp to feature; MODIFIER silent_mutation Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0404456120 T -> C LOC_Os04g08350.3 downstream_gene_variant ; 2202.0bp to feature; MODIFIER silent_mutation Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N
vg0404456120 T -> C LOC_Os04g08340-LOC_Os04g08350 intergenic_region ; MODIFIER silent_mutation Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404456120 NA 5.83E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120 NA 1.36E-07 mr1561 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120 NA 9.43E-07 mr1561 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120 NA 4.57E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120 4.45E-06 NA mr1167_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120 NA 1.77E-06 mr1319_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120 NA 1.59E-07 mr1380_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120 NA 5.75E-07 mr1380_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120 NA 9.13E-08 mr1561_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120 NA 5.75E-07 mr1561_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120 NA 8.48E-06 mr1723_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120 NA 4.92E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120 NA 3.61E-06 mr1908_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251