\
| Variant ID: vg0404456120 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4456120 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 277. )
ATTCTTTTCTGCCTTGTAACCTAAGACTTTGGTTTCATTGTTCACCTTATAGATATCTCTGTACGTGTTCTGTAGTTATCTTTAACAAGTAGCCAATGCT[T/C]
TAAAGGCTTCTTCAAGAATATGATATAAAAAAGGTGGATATACTATTCCCGTCGACTTTGTTCTATATATGATATCACGGTAAATATTTTTGCTTCTGTT
AACAGAAGCAAAAATATTTACCGTGATATCATATATAGAACAAAGTCGACGGGAATAGTATATCCACCTTTTTTATATCATATTCTTGAAGAAGCCTTTA[A/G]
AGCATTGGCTACTTGTTAAAGATAACTACAGAACACGTACAGAGATATCTATAAGGTGAACAATGAAACCAAAGTCTTAGGTTACAAGGCAGAAAAGAAT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.90% | 11.00% | 0.08% | 0.00% | NA |
| All Indica | 2759 | 81.60% | 18.40% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 97.80% | 1.90% | 0.37% | 0.00% | NA |
| Indica I | 595 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 65.10% | 34.80% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 81.40% | 18.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 5.60% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404456120 | T -> C | LOC_Os04g08340.1 | downstream_gene_variant ; 770.0bp to feature; MODIFIER | silent_mutation | Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| vg0404456120 | T -> C | LOC_Os04g08350.1 | downstream_gene_variant ; 1338.0bp to feature; MODIFIER | silent_mutation | Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| vg0404456120 | T -> C | LOC_Os04g08350.2 | downstream_gene_variant ; 1280.0bp to feature; MODIFIER | silent_mutation | Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| vg0404456120 | T -> C | LOC_Os04g08350.4 | downstream_gene_variant ; 2181.0bp to feature; MODIFIER | silent_mutation | Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| vg0404456120 | T -> C | LOC_Os04g08350.3 | downstream_gene_variant ; 2202.0bp to feature; MODIFIER | silent_mutation | Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| vg0404456120 | T -> C | LOC_Os04g08340-LOC_Os04g08350 | intergenic_region ; MODIFIER | silent_mutation | Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404456120 | NA | 5.83E-09 | mr1167 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404456120 | NA | 1.36E-07 | mr1561 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404456120 | NA | 9.43E-07 | mr1561 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404456120 | NA | 4.57E-07 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404456120 | 4.45E-06 | NA | mr1167_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404456120 | NA | 1.77E-06 | mr1319_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404456120 | NA | 1.59E-07 | mr1380_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404456120 | NA | 5.75E-07 | mr1380_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404456120 | NA | 9.13E-08 | mr1561_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404456120 | NA | 5.75E-07 | mr1561_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404456120 | NA | 8.48E-06 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404456120 | NA | 4.92E-06 | mr1875_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404456120 | NA | 3.61E-06 | mr1908_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |