Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404456120:

Variant ID: vg0404456120 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4456120
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCTTTTCTGCCTTGTAACCTAAGACTTTGGTTTCATTGTTCACCTTATAGATATCTCTGTACGTGTTCTGTAGTTATCTTTAACAAGTAGCCAATGCT[T/C]
TAAAGGCTTCTTCAAGAATATGATATAAAAAAGGTGGATATACTATTCCCGTCGACTTTGTTCTATATATGATATCACGGTAAATATTTTTGCTTCTGTT

Reverse complement sequence

AACAGAAGCAAAAATATTTACCGTGATATCATATATAGAACAAAGTCGACGGGAATAGTATATCCACCTTTTTTATATCATATTCTTGAAGAAGCCTTTA[A/G]
AGCATTGGCTACTTGTTAAAGATAACTACAGAACACGTACAGAGATATCTATAAGGTGAACAATGAAACCAAAGTCTTAGGTTACAAGGCAGAAAAGAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.90%	11.00%	0.08%	0.00%	NA
All Indica	2759	81.60%	18.40%	0.04%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	97.80%	1.90%	0.37%	0.00%	NA
Indica I	595	98.20%	1.80%	0.00%	0.00%	NA
Indica II	465	92.90%	7.10%	0.00%	0.00%	NA
Indica III	913	65.10%	34.80%	0.11%	0.00%	NA
Indica Intermediate	786	81.40%	18.60%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	5.60%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404456120	T -> C	LOC_Os04g08340.1	downstream_gene_variant ; 770.0bp to feature; MODIFIER	silent_mutation	Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0404456120	T -> C	LOC_Os04g08350.1	downstream_gene_variant ; 1338.0bp to feature; MODIFIER	silent_mutation	Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0404456120	T -> C	LOC_Os04g08350.2	downstream_gene_variant ; 1280.0bp to feature; MODIFIER	silent_mutation	Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0404456120	T -> C	LOC_Os04g08350.4	downstream_gene_variant ; 2181.0bp to feature; MODIFIER	silent_mutation	Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0404456120	T -> C	LOC_Os04g08350.3	downstream_gene_variant ; 2202.0bp to feature; MODIFIER	silent_mutation	Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0404456120	T -> C	LOC_Os04g08340-LOC_Os04g08350	intergenic_region ; MODIFIER	silent_mutation	Average:50.168; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404456120	NA	5.83E-09	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120	NA	1.36E-07	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120	NA	9.43E-07	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120	NA	4.57E-07	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120	4.45E-06	NA	mr1167_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120	NA	1.77E-06	mr1319_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120	NA	1.59E-07	mr1380_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120	NA	5.75E-07	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120	NA	9.13E-08	mr1561_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120	NA	5.75E-07	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120	NA	8.48E-06	mr1723_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120	NA	4.92E-06	mr1875_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404456120	NA	3.61E-06	mr1908_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251