\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404445369:

Variant ID: vg0404445369 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4445369
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.17, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


TCGGTGTATCGGTTGCTAAGGCGCAGCACCCCTGTAGTAGTTGTAGTCAGACCGCCAACGTCGTGTCCTCCCCCAAATCGAAGTTTATCCTCCTCTCATC[G/A]
AAAGATTGGGAACCCCCGTTGCTGCATCAAAAGACAACCAAATAAGGGAGGTTTGATCAACTCTATCAAGCCATTCACGAGGGATATGGTAGAAGATATA

Reverse complement sequence

TATATCTTCTACCATATCCCTCGTGAATGGCTTGATAGAGTTGATCAAACCTCCCTTATTTGGTTGTCTTTTGATGCAGCAACGGGGGTTCCCAATCTTT[C/T]
GATGAGAGGAGGATAAACTTCGATTTGGGGGAGGACACGACGTTGGCGGTCTGACTACAACTACTACAGGGGTGCTGCGCCTTAGCAACCGATACACCGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.30% 34.60% 2.79% 19.30% NA
All Indica  2759 25.60% 53.80% 3.04% 17.58% NA
All Japonica  1512 76.70% 0.70% 1.92% 20.70% NA
Aus  269 15.20% 43.50% 5.58% 35.69% NA
Indica I  595 3.90% 91.10% 1.01% 4.03% NA
Indica II  465 59.80% 25.40% 4.73% 10.11% NA
Indica III  913 16.00% 54.20% 2.74% 27.05% NA
Indica Intermediate  786 32.80% 42.00% 3.94% 21.25% NA
Temperate Japonica  767 95.00% 0.40% 0.26% 4.30% NA
Tropical Japonica  504 64.90% 0.60% 4.37% 30.16% NA
Japonica Intermediate  241 43.20% 1.70% 2.07% 53.11% NA
VI/Aromatic  96 88.50% 6.20% 2.08% 3.12% NA
Intermediate  90 62.20% 18.90% 2.22% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404445369 G -> DEL N N silent_mutation Average:70.519; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N
vg0404445369 G -> A LOC_Os04g08320.1 upstream_gene_variant ; 1365.0bp to feature; MODIFIER silent_mutation Average:70.519; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N
vg0404445369 G -> A LOC_Os04g08310.1 downstream_gene_variant ; 3712.0bp to feature; MODIFIER silent_mutation Average:70.519; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N
vg0404445369 G -> A LOC_Os04g08330.1 downstream_gene_variant ; 1280.0bp to feature; MODIFIER silent_mutation Average:70.519; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N
vg0404445369 G -> A LOC_Os04g08320-LOC_Os04g08330 intergenic_region ; MODIFIER silent_mutation Average:70.519; most accessible tissue: Minghui63 young leaf, score: 78.821 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404445369 NA 7.60E-16 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 3.05E-10 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 2.17E-16 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 6.46E-12 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 9.80E-17 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 9.71E-11 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 3.51E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 3.90E-17 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 7.31E-11 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 1.29E-08 mr1608 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 3.08E-16 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 7.20E-11 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 3.94E-14 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 7.33E-09 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 7.82E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 6.68E-08 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 2.11E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 1.55E-10 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 1.12E-17 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 1.28E-11 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 2.17E-09 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 1.97E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369 NA 5.22E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251