Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404445369:

Variant ID: vg0404445369 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4445369
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.85, A: 0.17, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

TCGGTGTATCGGTTGCTAAGGCGCAGCACCCCTGTAGTAGTTGTAGTCAGACCGCCAACGTCGTGTCCTCCCCCAAATCGAAGTTTATCCTCCTCTCATC[G/A]
AAAGATTGGGAACCCCCGTTGCTGCATCAAAAGACAACCAAATAAGGGAGGTTTGATCAACTCTATCAAGCCATTCACGAGGGATATGGTAGAAGATATA

Reverse complement sequence

TATATCTTCTACCATATCCCTCGTGAATGGCTTGATAGAGTTGATCAAACCTCCCTTATTTGGTTGTCTTTTGATGCAGCAACGGGGGTTCCCAATCTTT[C/T]
GATGAGAGGAGGATAAACTTCGATTTGGGGGAGGACACGACGTTGGCGGTCTGACTACAACTACTACAGGGGTGCTGCGCCTTAGCAACCGATACACCGA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.30%	34.60%	2.79%	19.30%	NA
All Indica	2759	25.60%	53.80%	3.04%	17.58%	NA
All Japonica	1512	76.70%	0.70%	1.92%	20.70%	NA
Aus	269	15.20%	43.50%	5.58%	35.69%	NA
Indica I	595	3.90%	91.10%	1.01%	4.03%	NA
Indica II	465	59.80%	25.40%	4.73%	10.11%	NA
Indica III	913	16.00%	54.20%	2.74%	27.05%	NA
Indica Intermediate	786	32.80%	42.00%	3.94%	21.25%	NA
Temperate Japonica	767	95.00%	0.40%	0.26%	4.30%	NA
Tropical Japonica	504	64.90%	0.60%	4.37%	30.16%	NA
Japonica Intermediate	241	43.20%	1.70%	2.07%	53.11%	NA
VI/Aromatic	96	88.50%	6.20%	2.08%	3.12%	NA
Intermediate	90	62.20%	18.90%	2.22%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404445369	G -> DEL	N	N	silent_mutation	Average:70.519; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N
vg0404445369	G -> A	LOC_Os04g08320.1	upstream_gene_variant ; 1365.0bp to feature; MODIFIER	silent_mutation	Average:70.519; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N
vg0404445369	G -> A	LOC_Os04g08310.1	downstream_gene_variant ; 3712.0bp to feature; MODIFIER	silent_mutation	Average:70.519; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N
vg0404445369	G -> A	LOC_Os04g08330.1	downstream_gene_variant ; 1280.0bp to feature; MODIFIER	silent_mutation	Average:70.519; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N
vg0404445369	G -> A	LOC_Os04g08320-LOC_Os04g08330	intergenic_region ; MODIFIER	silent_mutation	Average:70.519; most accessible tissue: Minghui63 young leaf, score: 78.821	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404445369	NA	7.60E-16	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	3.05E-10	mr1059	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	2.17E-16	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	6.46E-12	mr1143	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	9.80E-17	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	9.71E-11	mr1167	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	3.51E-09	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	3.90E-17	mr1535	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	7.31E-11	mr1535	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	1.29E-08	mr1608	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	3.08E-16	mr1675	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	7.20E-11	mr1675	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	3.94E-14	mr1726	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	7.33E-09	mr1726	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	7.82E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	6.68E-08	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	2.11E-14	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	1.55E-10	mr1969	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	1.12E-17	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	1.28E-11	mr1995	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	2.17E-09	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	1.97E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404445369	NA	5.22E-06	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251