\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404444524:

Variant ID: vg0404444524 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4444524
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.58, G: 0.44, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:


CGTACTAAAGCATGAGTTGTATAACAAACCTATCTGCTTCCATCTAAGAACTTTGATGGCAGATATTCGATATATATCTTTAATCAATCAATTCTTCCAT[A/G]
GGAAAAGAGAAAAACTTGATCAAAGATGATAAGGACATCCCTTCCAACGATACAACCATGCCTATTGCACAACAAGGACCAATGACTAGAGCTCGAGCTC

Reverse complement sequence

GAGCTCGAGCTCTAGTCATTGGTCCTTGTTGTGCAATAGGCATGGTTGTATCGTTGGAAGGGATGTCCTTATCATCTTTGATCAAGTTTTTCTCTTTTCC[T/C]
ATGGAAGAATTGATTGATTAAAGATATATATCGAATATCTGCCATCAAAGTTCTTAGATGGAAGCAGATAGGTTTGTTATACAACTCATGCTTTAGTACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.60% 44.20% 0.21% 0.00% NA
All Indica  2759 75.90% 23.80% 0.25% 0.00% NA
All Japonica  1512 12.50% 87.40% 0.13% 0.00% NA
Aus  269 95.20% 4.50% 0.37% 0.00% NA
Indica I  595 96.10% 3.90% 0.00% 0.00% NA
Indica II  465 31.60% 68.00% 0.43% 0.00% NA
Indica III  913 94.30% 5.60% 0.11% 0.00% NA
Indica Intermediate  786 65.40% 34.10% 0.51% 0.00% NA
Temperate Japonica  767 1.60% 98.40% 0.00% 0.00% NA
Tropical Japonica  504 22.60% 77.40% 0.00% 0.00% NA
Japonica Intermediate  241 26.10% 73.00% 0.83% 0.00% NA
VI/Aromatic  96 52.10% 47.90% 0.00% 0.00% NA
Intermediate  90 43.30% 56.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404444524 A -> G LOC_Os04g08320.1 upstream_gene_variant ; 520.0bp to feature; MODIFIER silent_mutation Average:72.228; most accessible tissue: Callus, score: 84.663 N N N N
vg0404444524 A -> G LOC_Os04g08310.1 downstream_gene_variant ; 2867.0bp to feature; MODIFIER silent_mutation Average:72.228; most accessible tissue: Callus, score: 84.663 N N N N
vg0404444524 A -> G LOC_Os04g08330.1 downstream_gene_variant ; 2125.0bp to feature; MODIFIER silent_mutation Average:72.228; most accessible tissue: Callus, score: 84.663 N N N N
vg0404444524 A -> G LOC_Os04g08320-LOC_Os04g08330 intergenic_region ; MODIFIER silent_mutation Average:72.228; most accessible tissue: Callus, score: 84.663 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404444524 NA 5.75E-16 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 2.05E-09 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 6.89E-18 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 1.12E-10 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 2.12E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 4.47E-09 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 1.91E-15 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 1.86E-09 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 5.13E-16 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 3.10E-09 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 3.79E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 1.33E-06 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 1.57E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 7.26E-09 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 7.81E-17 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 1.92E-09 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 4.02E-09 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 5.19E-06 mr1265_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 2.00E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 2.68E-08 mr1726_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 7.88E-10 mr1904_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404444524 NA 5.91E-06 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251