Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404430685:

Variant ID: vg0404430685 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4430685
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACTCGACGTAAAGACGAGGGACAACAAGTGGACTTATTCTATATATATCAACCATTATAATGGGCCAGTACAATTTGCCTTCGACCACTATGGGCCACTA[T/C]
GGTTGAGACTAGGGGTGAAAACGGTACGGAAACTTTCCAGATTCTGGACCTGTTTTCGGAAACGGAACCTGTCGGTCGGAATTTGTTTGGAATTTTTCAG

Reverse complement sequence

CTGAAAAATTCCAAACAAATTCCGACCGACAGGTTCCGTTTCCGAAAACAGGTCCAGAATCTGGAAAGTTTCCGTACCGTTTTCACCCCTAGTCTCAACC[A/G]
TAGTGGCCCATAGTGGTCGAAGGCAAATTGTACTGGCCCATTATAATGGTTGATATATATAGAATAAGTCCACTTGTTGTCCCTCGTCTTTACGTCGAGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.30%	15.80%	0.25%	28.59%	NA
All Indica	2759	45.10%	24.00%	0.33%	30.59%	NA
All Japonica	1512	75.10%	0.80%	0.00%	24.07%	NA
Aus	269	50.90%	7.40%	0.74%	40.89%	NA
Indica I	595	92.60%	1.30%	0.00%	6.05%	NA
Indica II	465	25.40%	19.80%	0.86%	53.98%	NA
Indica III	913	22.90%	45.90%	0.22%	31.00%	NA
Indica Intermediate	786	46.60%	18.20%	0.38%	34.86%	NA
Temperate Japonica	767	91.80%	0.30%	0.00%	7.95%	NA
Tropical Japonica	504	66.70%	1.40%	0.00%	31.94%	NA
Japonica Intermediate	241	39.80%	1.20%	0.00%	58.92%	NA
VI/Aromatic	96	49.00%	43.80%	0.00%	7.29%	NA
Intermediate	90	56.70%	13.30%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404430685	T -> C	LOC_Os04g08290.1	upstream_gene_variant ; 3002.0bp to feature; MODIFIER	silent_mutation	Average:46.58; most accessible tissue: Callus, score: 65.387	N	N	N	N
vg0404430685	T -> C	LOC_Os04g08300.1	upstream_gene_variant ; 2939.0bp to feature; MODIFIER	silent_mutation	Average:46.58; most accessible tissue: Callus, score: 65.387	N	N	N	N
vg0404430685	T -> C	LOC_Os04g08290-LOC_Os04g08300	intergenic_region ; MODIFIER	silent_mutation	Average:46.58; most accessible tissue: Callus, score: 65.387	N	N	N	N
vg0404430685	T -> DEL	N	N	silent_mutation	Average:46.58; most accessible tissue: Callus, score: 65.387	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404430685	7.71E-06	NA	mr1059	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685	6.14E-06	NA	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685	NA	5.75E-07	mr1950	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685	9.70E-07	NA	mr1167_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685	4.43E-06	5.09E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685	NA	5.07E-06	mr1698_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685	1.31E-06	NA	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685	2.56E-06	6.54E-07	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685	NA	5.77E-06	mr1950_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251