\
| Variant ID: vg0404430685 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4430685 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
ACTCGACGTAAAGACGAGGGACAACAAGTGGACTTATTCTATATATATCAACCATTATAATGGGCCAGTACAATTTGCCTTCGACCACTATGGGCCACTA[T/C]
GGTTGAGACTAGGGGTGAAAACGGTACGGAAACTTTCCAGATTCTGGACCTGTTTTCGGAAACGGAACCTGTCGGTCGGAATTTGTTTGGAATTTTTCAG
CTGAAAAATTCCAAACAAATTCCGACCGACAGGTTCCGTTTCCGAAAACAGGTCCAGAATCTGGAAAGTTTCCGTACCGTTTTCACCCCTAGTCTCAACC[A/G]
TAGTGGCCCATAGTGGTCGAAGGCAAATTGTACTGGCCCATTATAATGGTTGATATATATAGAATAAGTCCACTTGTTGTCCCTCGTCTTTACGTCGAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.30% | 15.80% | 0.25% | 28.59% | NA |
| All Indica | 2759 | 45.10% | 24.00% | 0.33% | 30.59% | NA |
| All Japonica | 1512 | 75.10% | 0.80% | 0.00% | 24.07% | NA |
| Aus | 269 | 50.90% | 7.40% | 0.74% | 40.89% | NA |
| Indica I | 595 | 92.60% | 1.30% | 0.00% | 6.05% | NA |
| Indica II | 465 | 25.40% | 19.80% | 0.86% | 53.98% | NA |
| Indica III | 913 | 22.90% | 45.90% | 0.22% | 31.00% | NA |
| Indica Intermediate | 786 | 46.60% | 18.20% | 0.38% | 34.86% | NA |
| Temperate Japonica | 767 | 91.80% | 0.30% | 0.00% | 7.95% | NA |
| Tropical Japonica | 504 | 66.70% | 1.40% | 0.00% | 31.94% | NA |
| Japonica Intermediate | 241 | 39.80% | 1.20% | 0.00% | 58.92% | NA |
| VI/Aromatic | 96 | 49.00% | 43.80% | 0.00% | 7.29% | NA |
| Intermediate | 90 | 56.70% | 13.30% | 1.11% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404430685 | T -> C | LOC_Os04g08290.1 | upstream_gene_variant ; 3002.0bp to feature; MODIFIER | silent_mutation | Average:46.58; most accessible tissue: Callus, score: 65.387 | N | N | N | N |
| vg0404430685 | T -> C | LOC_Os04g08300.1 | upstream_gene_variant ; 2939.0bp to feature; MODIFIER | silent_mutation | Average:46.58; most accessible tissue: Callus, score: 65.387 | N | N | N | N |
| vg0404430685 | T -> C | LOC_Os04g08290-LOC_Os04g08300 | intergenic_region ; MODIFIER | silent_mutation | Average:46.58; most accessible tissue: Callus, score: 65.387 | N | N | N | N |
| vg0404430685 | T -> DEL | N | N | silent_mutation | Average:46.58; most accessible tissue: Callus, score: 65.387 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404430685 | 7.71E-06 | NA | mr1059 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404430685 | 6.14E-06 | NA | mr1167 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404430685 | NA | 5.75E-07 | mr1950 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404430685 | 9.70E-07 | NA | mr1167_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404430685 | 4.43E-06 | 5.09E-07 | mr1167_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404430685 | NA | 5.07E-06 | mr1698_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404430685 | 1.31E-06 | NA | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404430685 | 2.56E-06 | 6.54E-07 | mr1726_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404430685 | NA | 5.77E-06 | mr1950_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |