\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404430685:

Variant ID: vg0404430685 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4430685
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTCGACGTAAAGACGAGGGACAACAAGTGGACTTATTCTATATATATCAACCATTATAATGGGCCAGTACAATTTGCCTTCGACCACTATGGGCCACTA[T/C]
GGTTGAGACTAGGGGTGAAAACGGTACGGAAACTTTCCAGATTCTGGACCTGTTTTCGGAAACGGAACCTGTCGGTCGGAATTTGTTTGGAATTTTTCAG

Reverse complement sequence

CTGAAAAATTCCAAACAAATTCCGACCGACAGGTTCCGTTTCCGAAAACAGGTCCAGAATCTGGAAAGTTTCCGTACCGTTTTCACCCCTAGTCTCAACC[A/G]
TAGTGGCCCATAGTGGTCGAAGGCAAATTGTACTGGCCCATTATAATGGTTGATATATATAGAATAAGTCCACTTGTTGTCCCTCGTCTTTACGTCGAGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 15.80% 0.25% 28.59% NA
All Indica  2759 45.10% 24.00% 0.33% 30.59% NA
All Japonica  1512 75.10% 0.80% 0.00% 24.07% NA
Aus  269 50.90% 7.40% 0.74% 40.89% NA
Indica I  595 92.60% 1.30% 0.00% 6.05% NA
Indica II  465 25.40% 19.80% 0.86% 53.98% NA
Indica III  913 22.90% 45.90% 0.22% 31.00% NA
Indica Intermediate  786 46.60% 18.20% 0.38% 34.86% NA
Temperate Japonica  767 91.80% 0.30% 0.00% 7.95% NA
Tropical Japonica  504 66.70% 1.40% 0.00% 31.94% NA
Japonica Intermediate  241 39.80% 1.20% 0.00% 58.92% NA
VI/Aromatic  96 49.00% 43.80% 0.00% 7.29% NA
Intermediate  90 56.70% 13.30% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404430685 T -> C LOC_Os04g08290.1 upstream_gene_variant ; 3002.0bp to feature; MODIFIER silent_mutation Average:46.58; most accessible tissue: Callus, score: 65.387 N N N N
vg0404430685 T -> C LOC_Os04g08300.1 upstream_gene_variant ; 2939.0bp to feature; MODIFIER silent_mutation Average:46.58; most accessible tissue: Callus, score: 65.387 N N N N
vg0404430685 T -> C LOC_Os04g08290-LOC_Os04g08300 intergenic_region ; MODIFIER silent_mutation Average:46.58; most accessible tissue: Callus, score: 65.387 N N N N
vg0404430685 T -> DEL N N silent_mutation Average:46.58; most accessible tissue: Callus, score: 65.387 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404430685 7.71E-06 NA mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685 6.14E-06 NA mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685 NA 5.75E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685 9.70E-07 NA mr1167_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685 4.43E-06 5.09E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685 NA 5.07E-06 mr1698_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685 1.31E-06 NA mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685 2.56E-06 6.54E-07 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404430685 NA 5.77E-06 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251