RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0404403925:

Variant ID: vg0404403925 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4403925
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GTTGGGAACCTGGACAAACGAACTGAGCCTTAGAAGCAGTAGCGGCATGCACGACGATGGATAGAAAAGGAGAGGAGGGATCTAGCCACACTGCTTGGAT[C/T]
TGCTCGTGAGCACCGAAGCTCGTTGCTCACGCCCTCCTCGGGAGTTGCCATGGCATGGGAAAGAGAGGATGTCCACGGCGACGATGACGACGAAGCAGCG

Reverse complement sequence

CGCTGCTTCGTCGTCATCGTCGCCGTGGACATCCTCTCTTTCCCATGCCATGGCAACTCCCGAGGAGGGCGTGAGCAACGAGCTTCGGTGCTCACGAGCA[G/A]
ATCCAAGCAGTGTGGCTAGATCCCTCCTCTCCTTTTCTATCCATCGTCGTGCATGCCGCTACTGCTTCTAAGGCTCAGTTCGTTTGTCCAGGTTCCCAAC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.10%	14.80%	0.13%	0.00%	NA
All Indica	2759	75.50%	24.30%	0.22%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	92.20%	7.80%	0.00%	0.00%	NA
Indica I	595	98.70%	1.20%	0.17%	0.00%	NA
Indica II	465	76.60%	23.20%	0.22%	0.00%	NA
Indica III	913	56.70%	43.00%	0.22%	0.00%	NA
Indica Intermediate	786	79.10%	20.60%	0.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	6.70%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404403925	C -> T	LOC_Os04g08250.1	upstream_gene_variant ; 1045.0bp to feature; MODIFIER	silent_mutation	Average:66.226; most accessible tissue: Callus, score: 88.801	N	N	N	N
vg0404403925	C -> T	LOC_Os04g08260.1	upstream_gene_variant ; 217.0bp to feature; MODIFIER	silent_mutation	Average:66.226; most accessible tissue: Callus, score: 88.801	N	N	N	N
vg0404403925	C -> T	LOC_Os04g08250-LOC_Os04g08260	intergenic_region ; MODIFIER	silent_mutation	Average:66.226; most accessible tissue: Callus, score: 88.801	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404403925	1.58E-06	NA	mr1167_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404403925	3.20E-06	NA	mr1167_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404403925	9.04E-06	NA	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404403925	1.74E-06	2.22E-06	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404403925	4.46E-06	NA	mr1950_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404403925	2.60E-06	1.30E-06	mr1950_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 6 of 6 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0404403925:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact