\
| Variant ID: vg0404394612 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4394612 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.32, others allele: 0.00, population size: 82. )
TTAAACAAAGTAATTAAATAACATAAGAAAGGAACACGAATGCTTACTTTATAGAAGAAGTTCTCCGAACCCGGAGCAGAGTGTACCGATAGCTCCGGTA[T/C]
TCCTCCAGAATTCCTCCTAGGAAGCTACACTCGTCGAGGTAGAAGTCGGATGAGCGCCAAACTTTCGGGCACTCCTCCAAAGCTTTCCCTCACTCTCTAC
GTAGAGAGTGAGGGAAAGCTTTGGAGGAGTGCCCGAAAGTTTGGCGCTCATCCGACTTCTACCTCGACGAGTGTAGCTTCCTAGGAGGAATTCTGGAGGA[A/G]
TACCGGAGCTATCGGTACACTCTGCTCCGGGTTCGGAGAACTTCTTCTATAAAGTAAGCATTCGTGTTCCTTTCTTATGTTATTTAATTACTTTGTTTAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.70% | 18.70% | 5.33% | 7.19% | NA |
| All Indica | 2759 | 88.00% | 2.90% | 5.04% | 4.10% | NA |
| All Japonica | 1512 | 36.90% | 51.10% | 2.78% | 9.19% | NA |
| Aus | 269 | 39.80% | 7.10% | 21.93% | 31.23% | NA |
| Indica I | 595 | 94.80% | 1.00% | 0.67% | 3.53% | NA |
| Indica II | 465 | 95.30% | 4.50% | 0.22% | 0.00% | NA |
| Indica III | 913 | 84.40% | 2.00% | 9.09% | 4.49% | NA |
| Indica Intermediate | 786 | 82.60% | 4.50% | 6.49% | 6.49% | NA |
| Temperate Japonica | 767 | 8.70% | 87.00% | 1.69% | 2.61% | NA |
| Tropical Japonica | 504 | 71.40% | 10.10% | 1.79% | 16.67% | NA |
| Japonica Intermediate | 241 | 54.40% | 22.80% | 8.30% | 14.52% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 4.17% | 1.04% | NA |
| Intermediate | 90 | 72.20% | 15.60% | 8.89% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404394612 | T -> C | LOC_Os04g08230.1 | upstream_gene_variant ; 949.0bp to feature; MODIFIER | silent_mutation | Average:20.033; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0404394612 | T -> C | LOC_Os04g08240.1 | downstream_gene_variant ; 2629.0bp to feature; MODIFIER | silent_mutation | Average:20.033; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0404394612 | T -> C | LOC_Os04g08230-LOC_Os04g08240 | intergenic_region ; MODIFIER | silent_mutation | Average:20.033; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| vg0404394612 | T -> DEL | N | N | silent_mutation | Average:20.033; most accessible tissue: Zhenshan97 panicle, score: 36.038 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404394612 | NA | 4.65E-07 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404394612 | NA | 1.58E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404394612 | 9.19E-06 | 9.15E-06 | mr1703 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404394612 | 6.81E-06 | 6.82E-06 | mr1703 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404394612 | 4.40E-07 | 4.40E-07 | mr1781 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404394612 | NA | 1.86E-06 | mr1942 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404394612 | NA | 8.83E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404394612 | NA | 6.71E-09 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |