\
| Variant ID: vg0404393344 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4393344 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.77, A: 0.24, others allele: 0.00, population size: 82. )
TCGGCCGAAAGAATCATTCTCTAAGATTAGATCTAAGAGTTCTCTTCCTTCGGCGGTTGTCTTGTGTGCGAAGGATCCTCCGGCGGAGATATCAAGATTT[A/G]
CGGTAGACTCCTTGTCTAACCCGTACCAAAAATGTTGTAACAACACATGGTCAGGTAAAGACAAGTCTGGACCAGACTAAGTTAACAGTAAGAACCTAGC
GCTAGGTTCTTACTGTTAACTTAGTCTGGTCCAGACTTGTCTTTACCTGACCATGTGTTGTTACAACATTTTTGGTACGGGTTAGACAAGGAGTCTACCG[T/C]
AAATCTTGATATCTCCGCCGGAGGATCCTTCGCACACAAGACAACCGCCGAAGGAAGAGAACTCTTAGATCTAATCTTAGAGAATGATTCTTTCGGCCGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 39.70% | 18.30% | 0.72% | 41.37% | NA |
| All Indica | 2759 | 59.20% | 2.40% | 0.91% | 37.55% | NA |
| All Japonica | 1512 | 3.70% | 50.30% | 0.26% | 45.77% | NA |
| Aus | 269 | 34.20% | 6.70% | 0.00% | 59.11% | NA |
| Indica I | 595 | 94.10% | 0.50% | 0.00% | 5.38% | NA |
| Indica II | 465 | 64.50% | 4.50% | 0.65% | 30.32% | NA |
| Indica III | 913 | 36.80% | 1.60% | 0.99% | 60.57% | NA |
| Indica Intermediate | 786 | 55.50% | 3.40% | 1.65% | 39.44% | NA |
| Temperate Japonica | 767 | 1.40% | 86.80% | 0.00% | 11.73% | NA |
| Tropical Japonica | 504 | 5.40% | 9.10% | 0.79% | 84.72% | NA |
| Japonica Intermediate | 241 | 7.50% | 19.90% | 0.00% | 72.61% | NA |
| VI/Aromatic | 96 | 51.00% | 1.00% | 3.12% | 44.79% | NA |
| Intermediate | 90 | 50.00% | 20.00% | 2.22% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404393344 | A -> DEL | N | N | silent_mutation | Average:19.303; most accessible tissue: Zhenshan97 root, score: 47.644 | N | N | N | N |
| vg0404393344 | A -> G | LOC_Os04g08240.1 | downstream_gene_variant ; 3897.0bp to feature; MODIFIER | silent_mutation | Average:19.303; most accessible tissue: Zhenshan97 root, score: 47.644 | N | N | N | N |
| vg0404393344 | A -> G | LOC_Os04g08230.1 | intron_variant ; MODIFIER | silent_mutation | Average:19.303; most accessible tissue: Zhenshan97 root, score: 47.644 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404393344 | NA | 3.19E-07 | mr1030_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404393344 | 2.96E-06 | NA | mr1235_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404393344 | NA | 4.86E-06 | mr1330_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404393344 | 1.22E-06 | NA | mr1423_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404393344 | 7.72E-06 | NA | mr1860_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404393344 | NA | 1.24E-06 | mr1860_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |