Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0404351840:

Variant ID: vg0404351840 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4351840
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTCCGTGTTGTTGAAGGCTTTGTTGTTTTGGCATTTCCAAATGTTCCAAGTGATCGCAAGGAGAATTGTGTGCCAAATCCGTTGAATTTTGAACATGC[A/G]
GGTAATGAAAAAATATAAGTTGAAGTAAAGTGGAATTTATTGGTTGGAAAAACCAGCATGATGGAATCATGTAATCCATCTCGTGTATTTGCTTGTAGTA

Reverse complement sequence

TACTACAAGCAAATACACGAGATGGATTACATGATTCCATCATGCTGGTTTTTCCAACCAATAAATTCCACTTTACTTCAACTTATATTTTTTCATTACC[T/C]
GCATGTTCAAAATTCAACGGATTTGGCACACAATTCTCCTTGCGATCACTTGGAACATTTGGAAATGCCAAAACAACAAAGCCTTCAACAACACGGACGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.40%	8.00%	0.47%	31.19%	NA
All Indica	2759	46.40%	12.80%	0.58%	40.23%	NA
All Japonica	1512	90.30%	0.20%	0.07%	9.39%	NA
Aus	269	40.50%	2.20%	1.86%	55.39%	NA
Indica I	595	96.80%	1.20%	0.00%	2.02%	NA
Indica II	465	24.90%	40.40%	1.29%	33.33%	NA
Indica III	913	25.60%	3.00%	0.33%	71.08%	NA
Indica Intermediate	786	44.90%	16.80%	0.89%	37.40%	NA
Temperate Japonica	767	95.30%	0.30%	0.00%	4.43%	NA
Tropical Japonica	504	91.10%	0.00%	0.20%	8.73%	NA
Japonica Intermediate	241	73.00%	0.40%	0.00%	26.56%	NA
VI/Aromatic	96	47.90%	2.10%	0.00%	50.00%	NA
Intermediate	90	58.90%	13.30%	0.00%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404351840	A -> DEL	LOC_Os04g08180.1	N	frameshift_variant	Average:36.177; most accessible tissue: Zhenshan97 young leaf, score: 49.329	N	N	N	N
vg0404351840	A -> G	LOC_Os04g08180.1	splice_region_variant&synonymous_variant ; p.Ala185Ala; LOW	synonymous_codon	Average:36.177; most accessible tissue: Zhenshan97 young leaf, score: 49.329	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404351840	NA	2.70E-07	mr1035	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840	NA	2.86E-06	mr1062	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840	NA	7.90E-06	mr1333	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840	NA	2.84E-07	mr1626	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840	NA	8.22E-06	mr1631	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840	NA	9.46E-07	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840	3.27E-07	3.27E-07	mr1035_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840	NA	2.32E-09	mr1062_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840	NA	2.45E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840	NA	6.04E-07	mr1360_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840	NA	5.54E-17	mr1715_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840	NA	1.65E-12	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840	NA	2.64E-07	mr1895_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840	NA	1.94E-06	mr1931_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251