\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404351840:

Variant ID: vg0404351840 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4351840
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTCCGTGTTGTTGAAGGCTTTGTTGTTTTGGCATTTCCAAATGTTCCAAGTGATCGCAAGGAGAATTGTGTGCCAAATCCGTTGAATTTTGAACATGC[A/G]
GGTAATGAAAAAATATAAGTTGAAGTAAAGTGGAATTTATTGGTTGGAAAAACCAGCATGATGGAATCATGTAATCCATCTCGTGTATTTGCTTGTAGTA

Reverse complement sequence

TACTACAAGCAAATACACGAGATGGATTACATGATTCCATCATGCTGGTTTTTCCAACCAATAAATTCCACTTTACTTCAACTTATATTTTTTCATTACC[T/C]
GCATGTTCAAAATTCAACGGATTTGGCACACAATTCTCCTTGCGATCACTTGGAACATTTGGAAATGCCAAAACAACAAAGCCTTCAACAACACGGACGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.40% 8.00% 0.47% 31.19% NA
All Indica  2759 46.40% 12.80% 0.58% 40.23% NA
All Japonica  1512 90.30% 0.20% 0.07% 9.39% NA
Aus  269 40.50% 2.20% 1.86% 55.39% NA
Indica I  595 96.80% 1.20% 0.00% 2.02% NA
Indica II  465 24.90% 40.40% 1.29% 33.33% NA
Indica III  913 25.60% 3.00% 0.33% 71.08% NA
Indica Intermediate  786 44.90% 16.80% 0.89% 37.40% NA
Temperate Japonica  767 95.30% 0.30% 0.00% 4.43% NA
Tropical Japonica  504 91.10% 0.00% 0.20% 8.73% NA
Japonica Intermediate  241 73.00% 0.40% 0.00% 26.56% NA
VI/Aromatic  96 47.90% 2.10% 0.00% 50.00% NA
Intermediate  90 58.90% 13.30% 0.00% 27.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404351840 A -> DEL LOC_Os04g08180.1 N frameshift_variant Average:36.177; most accessible tissue: Zhenshan97 young leaf, score: 49.329 N N N N
vg0404351840 A -> G LOC_Os04g08180.1 splice_region_variant&synonymous_variant ; p.Ala185Ala; LOW synonymous_codon Average:36.177; most accessible tissue: Zhenshan97 young leaf, score: 49.329 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404351840 NA 2.70E-07 mr1035 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840 NA 2.86E-06 mr1062 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840 NA 7.90E-06 mr1333 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840 NA 2.84E-07 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840 NA 8.22E-06 mr1631 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840 NA 9.46E-07 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840 3.27E-07 3.27E-07 mr1035_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840 NA 2.32E-09 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840 NA 2.45E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840 NA 6.04E-07 mr1360_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840 NA 5.54E-17 mr1715_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840 NA 1.65E-12 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840 NA 2.64E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404351840 NA 1.94E-06 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251