\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404327458:

Variant ID: vg0404327458 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4327458
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.25, others allele: 0.00, population size: 51. )

Flanking Sequence (100 bp) in Reference Genome:


GATCTCGCCCATCAGCTCCGGCTGGAGGTCAGAGAAGCCGGTCGTCGCCGCCGGCAGCGGCGGCAACGGCGGCGCGCGCATCTCCGGGAGGCGGTAACGA[C/T]
TATTCCGAGATTTGGGCTGGCACCAGGAGGAGCGTGGGATTGACAGAATATTCTTGAGTTTCCCTTTACTATATCTCCTTGGAAAAAGTACACAGAAGGT

Reverse complement sequence

ACCTTCTGTGTACTTTTTCCAAGGAGATATAGTAAAGGGAAACTCAAGAATATTCTGTCAATCCCACGCTCCTCCTGGTGCCAGCCCAAATCTCGGAATA[G/A]
TCGTTACCGCCTCCCGGAGATGCGCGCGCCGCCGTTGCCGCCGCTGCCGGCGGCGACGACCGGCTTCTCTGACCTCCAGCCGGAGCTGATGGGCGAGATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 41.80% 36.40% 9.23% 12.61% NA
All Indica  2759 20.50% 53.10% 11.67% 14.72% NA
All Japonica  1512 83.10% 5.60% 3.31% 8.07% NA
Aus  269 21.20% 39.80% 17.10% 21.93% NA
Indica I  595 5.00% 89.70% 1.01% 4.20% NA
Indica II  465 54.20% 20.60% 16.77% 8.39% NA
Indica III  913 5.60% 55.50% 13.36% 25.52% NA
Indica Intermediate  786 29.60% 41.70% 14.76% 13.87% NA
Temperate Japonica  767 95.40% 2.90% 1.17% 0.52% NA
Tropical Japonica  504 70.80% 4.60% 3.97% 20.63% NA
Japonica Intermediate  241 69.30% 16.20% 8.71% 5.81% NA
VI/Aromatic  96 47.90% 35.40% 12.50% 4.17% NA
Intermediate  90 54.40% 33.30% 6.67% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404327458 C -> DEL N N silent_mutation Average:80.456; most accessible tissue: Zhenshan97 flower, score: 94.981 N N N N
vg0404327458 C -> T LOC_Os04g08110.1 upstream_gene_variant ; 20.0bp to feature; MODIFIER silent_mutation Average:80.456; most accessible tissue: Zhenshan97 flower, score: 94.981 N N N N
vg0404327458 C -> T LOC_Os04g08120.1 downstream_gene_variant ; 3274.0bp to feature; MODIFIER silent_mutation Average:80.456; most accessible tissue: Zhenshan97 flower, score: 94.981 N N N N
vg0404327458 C -> T LOC_Os04g08110-LOC_Os04g08120 intergenic_region ; MODIFIER silent_mutation Average:80.456; most accessible tissue: Zhenshan97 flower, score: 94.981 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0404327458 C T 0.03 0.02 0.04 0.0 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404327458 NA 2.25E-21 mr1059 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 1.58E-11 mr1059 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 8.38E-23 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 1.90E-13 mr1143 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 3.64E-22 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 5.06E-12 mr1167 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 8.27E-21 mr1535 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 5.79E-12 mr1535 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 7.12E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 1.04E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 1.04E-20 mr1675 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 2.23E-11 mr1675 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 4.27E-07 mr1677 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 2.40E-17 mr1726 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 1.46E-09 mr1726 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 1.42E-16 mr1950 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 5.38E-07 mr1950 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 7.72E-20 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 1.35E-11 mr1969 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 3.79E-24 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 2.06E-13 mr1995 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 2.01E-07 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 1.59E-25 mr1167_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 1.79E-11 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 7.08E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 4.53E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 1.41E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 8.31E-18 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 9.89E-07 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 1.51E-07 mr1830_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 2.03E-06 mr1842_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 3.19E-06 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 2.64E-16 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 4.26E-07 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404327458 NA 9.30E-06 mr1971_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251