\
| Variant ID: vg0404315449 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4315449 |
| Reference Allele: C | Alternative Allele: T,A |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAATAGCTTCCGATAACATTTTTCTGGAAAACAAAAAGATATTAGAGATTTATAGTATATATTAGAACACGCACATAATGTGATATAAAAACTAACGAAT[C/T,A]
AAGTACTGCTCAATGAAACTATCTGTACCCTTGAAAAAAAATCACAAACCAAATAAATTGAGATATGGCCAAGTGAAAATAGAATGTAGATAGGTGAAAG
CTTTCACCTATCTACATTCTATTTTCACTTGGCCATATCTCAATTTATTTGGTTTGTGATTTTTTTTCAAGGGTACAGATAGTTTCATTGAGCAGTACTT[G/A,T]
ATTCGTTAGTTTTTATATCACATTATGTGCGTGTTCTAATATATACTATAAATCTCTAATATCTTTTTGTTTTCCAGAAAAATGTTATCGGAAGCTATTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.90% | 3.10% | 1.90% | 36.08% | A: 0.04% |
| All Indica | 2759 | 67.10% | 3.00% | 1.34% | 28.56% | NA |
| All Japonica | 1512 | 46.20% | 0.20% | 3.11% | 50.53% | NA |
| Aus | 269 | 45.00% | 21.20% | 1.12% | 32.71% | NA |
| Indica I | 595 | 90.60% | 0.80% | 0.50% | 8.07% | NA |
| Indica II | 465 | 82.60% | 0.60% | 0.65% | 16.13% | NA |
| Indica III | 913 | 41.50% | 6.20% | 1.86% | 50.38% | NA |
| Indica Intermediate | 786 | 69.70% | 2.40% | 1.78% | 26.08% | NA |
| Temperate Japonica | 767 | 65.10% | 0.00% | 0.78% | 34.16% | NA |
| Tropical Japonica | 504 | 16.10% | 0.40% | 3.97% | 79.56% | NA |
| Japonica Intermediate | 241 | 49.00% | 0.40% | 8.71% | 41.91% | NA |
| VI/Aromatic | 96 | 55.20% | 1.00% | 0.00% | 43.75% | NA |
| Intermediate | 90 | 66.70% | 2.20% | 3.33% | 25.56% | A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404315449 | C -> DEL | N | N | silent_mutation | Average:49.113; most accessible tissue: Callus, score: 66.381 | N | N | N | N |
| vg0404315449 | C -> A | LOC_Os04g08080.1 | downstream_gene_variant ; 3470.0bp to feature; MODIFIER | silent_mutation | Average:49.113; most accessible tissue: Callus, score: 66.381 | N | N | N | N |
| vg0404315449 | C -> A | LOC_Os04g08070-LOC_Os04g08080 | intergenic_region ; MODIFIER | silent_mutation | Average:49.113; most accessible tissue: Callus, score: 66.381 | N | N | N | N |
| vg0404315449 | C -> T | LOC_Os04g08080.1 | downstream_gene_variant ; 3470.0bp to feature; MODIFIER | silent_mutation | Average:49.113; most accessible tissue: Callus, score: 66.381 | N | N | N | N |
| vg0404315449 | C -> T | LOC_Os04g08070-LOC_Os04g08080 | intergenic_region ; MODIFIER | silent_mutation | Average:49.113; most accessible tissue: Callus, score: 66.381 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404315449 | NA | 7.95E-06 | mr1181_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404315449 | NA | 9.34E-06 | mr1350_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404315449 | 4.67E-06 | NA | mr1659_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404315449 | NA | 6.13E-06 | mr1726_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404315449 | NA | 8.45E-06 | mr1950_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |