\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404315449:

Variant ID: vg0404315449 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4315449
Reference Allele: CAlternative Allele: T,A
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAATAGCTTCCGATAACATTTTTCTGGAAAACAAAAAGATATTAGAGATTTATAGTATATATTAGAACACGCACATAATGTGATATAAAAACTAACGAAT[C/T,A]
AAGTACTGCTCAATGAAACTATCTGTACCCTTGAAAAAAAATCACAAACCAAATAAATTGAGATATGGCCAAGTGAAAATAGAATGTAGATAGGTGAAAG

Reverse complement sequence

CTTTCACCTATCTACATTCTATTTTCACTTGGCCATATCTCAATTTATTTGGTTTGTGATTTTTTTTCAAGGGTACAGATAGTTTCATTGAGCAGTACTT[G/A,T]
ATTCGTTAGTTTTTATATCACATTATGTGCGTGTTCTAATATATACTATAAATCTCTAATATCTTTTTGTTTTCCAGAAAAATGTTATCGGAAGCTATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 3.10% 1.90% 36.08% A: 0.04%
All Indica  2759 67.10% 3.00% 1.34% 28.56% NA
All Japonica  1512 46.20% 0.20% 3.11% 50.53% NA
Aus  269 45.00% 21.20% 1.12% 32.71% NA
Indica I  595 90.60% 0.80% 0.50% 8.07% NA
Indica II  465 82.60% 0.60% 0.65% 16.13% NA
Indica III  913 41.50% 6.20% 1.86% 50.38% NA
Indica Intermediate  786 69.70% 2.40% 1.78% 26.08% NA
Temperate Japonica  767 65.10% 0.00% 0.78% 34.16% NA
Tropical Japonica  504 16.10% 0.40% 3.97% 79.56% NA
Japonica Intermediate  241 49.00% 0.40% 8.71% 41.91% NA
VI/Aromatic  96 55.20% 1.00% 0.00% 43.75% NA
Intermediate  90 66.70% 2.20% 3.33% 25.56% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404315449 C -> DEL N N silent_mutation Average:49.113; most accessible tissue: Callus, score: 66.381 N N N N
vg0404315449 C -> A LOC_Os04g08080.1 downstream_gene_variant ; 3470.0bp to feature; MODIFIER silent_mutation Average:49.113; most accessible tissue: Callus, score: 66.381 N N N N
vg0404315449 C -> A LOC_Os04g08070-LOC_Os04g08080 intergenic_region ; MODIFIER silent_mutation Average:49.113; most accessible tissue: Callus, score: 66.381 N N N N
vg0404315449 C -> T LOC_Os04g08080.1 downstream_gene_variant ; 3470.0bp to feature; MODIFIER silent_mutation Average:49.113; most accessible tissue: Callus, score: 66.381 N N N N
vg0404315449 C -> T LOC_Os04g08070-LOC_Os04g08080 intergenic_region ; MODIFIER silent_mutation Average:49.113; most accessible tissue: Callus, score: 66.381 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404315449 NA 7.95E-06 mr1181_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404315449 NA 9.34E-06 mr1350_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404315449 4.67E-06 NA mr1659_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404315449 NA 6.13E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404315449 NA 8.45E-06 mr1950_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251