\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404314509:

Variant ID: vg0404314509 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 4314509
Reference Allele: AAlternative Allele: T,ATTT,AGTTCGATTT
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTTTCAAAAAAATTATGTTTGAATGATGAGCATACGTACAAATTAAGGCGGATGCACGGTCACTTTCGTGGACTTGGACGGTCTTTTTGTTTAACTAG[A/T,ATTT,AGTTCGATTT]
TGATACCCCGCGCGTTGCTGCGGACACTTAAGCAAACTTTTATCAATAGCTTTGAAAAAGCAATAGAAGGATTGTACATTACTTAAAATATGCCAACATA

Reverse complement sequence

TATGTTGGCATATTTTAAGTAATGTACAATCCTTCTATTGCTTTTTCAAAGCTATTGATAAAAGTTTGCTTAAGTGTCCGCAGCAACGCGCGGGGTATCA[T/A,AAAT,AAATCGAACT]
CTAGTTAAACAAAAAGACCGTCCAAGTCCACGAAAGTGACCGTGCATCCGCCTTAATTTGTACGTATGCTCATCATTCAAACATAATTTTTTTGAAAAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.70% 5.60% 6.03% 25.03% ATTT: 0.47%; AGTTCGATTT: 0.13%
All Indica  2759 69.50% 5.80% 6.71% 17.51% ATTT: 0.47%
All Japonica  1512 48.30% 5.60% 4.70% 40.54% ATTT: 0.53%; AGTTCGATTT: 0.40%
Aus  269 75.10% 3.70% 5.95% 15.24% NA
Indica I  595 94.60% 0.70% 2.86% 1.68% ATTT: 0.17%
Indica II  465 82.20% 3.40% 2.15% 12.04% ATTT: 0.22%
Indica III  913 45.60% 12.00% 10.19% 31.33% ATTT: 0.88%
Indica Intermediate  786 70.70% 3.90% 8.27% 16.67% ATTT: 0.38%
Temperate Japonica  767 63.10% 1.30% 2.74% 31.94% AGTTCGATTT: 0.52%; ATTT: 0.39%
Tropical Japonica  504 20.60% 12.70% 8.53% 57.34% ATTT: 0.60%; AGTTCGATTT: 0.20%
Japonica Intermediate  241 58.90% 4.10% 2.90% 32.78% ATTT: 0.83%; AGTTCGATTT: 0.41%
VI/Aromatic  96 54.20% 8.30% 6.25% 30.21% ATTT: 1.04%
Intermediate  90 68.90% 4.40% 7.78% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404314509 A -> DEL N N silent_mutation Average:66.541; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg0404314509 A -> ATTT LOC_Os04g08070.1 upstream_gene_variant ; 4062.0bp to feature; MODIFIER silent_mutation Average:66.541; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg0404314509 A -> ATTT LOC_Os04g08080.1 downstream_gene_variant ; 4409.0bp to feature; MODIFIER silent_mutation Average:66.541; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg0404314509 A -> ATTT LOC_Os04g08070-LOC_Os04g08080 intergenic_region ; MODIFIER silent_mutation Average:66.541; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg0404314509 A -> AGTTCGATTT LOC_Os04g08070.1 upstream_gene_variant ; 4062.0bp to feature; MODIFIER silent_mutation Average:66.541; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg0404314509 A -> AGTTCGATTT LOC_Os04g08080.1 downstream_gene_variant ; 4409.0bp to feature; MODIFIER silent_mutation Average:66.541; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg0404314509 A -> AGTTCGATTT LOC_Os04g08070-LOC_Os04g08080 intergenic_region ; MODIFIER silent_mutation Average:66.541; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg0404314509 A -> T LOC_Os04g08070.1 upstream_gene_variant ; 4061.0bp to feature; MODIFIER silent_mutation Average:66.541; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg0404314509 A -> T LOC_Os04g08080.1 downstream_gene_variant ; 4410.0bp to feature; MODIFIER silent_mutation Average:66.541; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N
vg0404314509 A -> T LOC_Os04g08070-LOC_Os04g08080 intergenic_region ; MODIFIER silent_mutation Average:66.541; most accessible tissue: Zhenshan97 root, score: 92.145 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0404314509 A AGTTC* -0.85 -0.22 -0.13 -0.03 -0.1 0.0
vg0404314509 A ATTT -0.7 -0.08 0.0 -0.01 -0.11 -0.03
vg0404314509 A T -0.03 0.01 0.02 0.0 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404314509 NA 4.74E-07 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404314509 5.19E-07 4.49E-09 mr1037_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404314509 NA 1.28E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404314509 1.31E-07 2.34E-09 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251