\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404303529:

Variant ID: vg0404303529 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4303529
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.51, G: 0.49, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


GGTTGGATTGGATGGATCTCTCCCTACCTTGATTTGGTGGTCTTTCTTGTGAACGCTCACATTCTTCCACTAGGCACACTCAGATTATTTTGCAGTAACA[G/A]
ATGATCAAACGGGTAGTTTAGGTCATGTTCTTTTCAGTTTATTCACCGGATTTTTTTATCTTTGCGCTTTAAATAAATATGTTTTCTTAAAAAAAATCTT

Reverse complement sequence

AAGATTTTTTTTAAGAAAACATATTTATTTAAAGCGCAAAGATAAAAAAATCCGGTGAATAAACTGAAAAGAACATGACCTAAACTACCCGTTTGATCAT[C/T]
TGTTACTGCAAAATAATCTGAGTGTGCCTAGTGGAAGAATGTGAGCGTTCACAAGAAAGACCACCAAATCAAGGTAGGGAGAGATCCATCCAATCCAACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 69.10% 29.00% 0.53% 1.38% NA
All Indica  2759 58.10% 40.20% 0.62% 1.01% NA
All Japonica  1512 87.40% 9.70% 0.53% 2.38% NA
Aus  269 68.00% 32.00% 0.00% 0.00% NA
Indica I  595 9.10% 90.40% 0.50% 0.00% NA
Indica II  465 86.50% 12.70% 0.22% 0.65% NA
Indica III  913 70.60% 26.10% 1.10% 2.19% NA
Indica Intermediate  786 64.00% 35.00% 0.38% 0.64% NA
Temperate Japonica  767 97.90% 1.70% 0.13% 0.26% NA
Tropical Japonica  504 87.30% 9.70% 0.20% 2.78% NA
Japonica Intermediate  241 54.40% 34.90% 2.49% 8.30% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404303529 G -> DEL N N silent_mutation Average:85.764; most accessible tissue: Callus, score: 97.904 N N N N
vg0404303529 G -> A LOC_Os04g08070.1 downstream_gene_variant ; 4896.0bp to feature; MODIFIER silent_mutation Average:85.764; most accessible tissue: Callus, score: 97.904 N N N N
vg0404303529 G -> A LOC_Os04g08060-LOC_Os04g08070 intergenic_region ; MODIFIER silent_mutation Average:85.764; most accessible tissue: Callus, score: 97.904 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0404303529 G A 0.0 0.02 0.01 -0.02 -0.04 -0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404303529 NA 5.16E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 4.01E-07 mr1715 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 2.03E-11 mr1902 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 3.81E-07 mr1902 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 2.10E-07 mr1062_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 5.65E-06 mr1118_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 6.94E-06 mr1120_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 3.13E-06 mr1240_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 9.11E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 3.70E-08 mr1348_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 8.91E-07 mr1496_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 2.45E-06 mr1528_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 1.13E-07 mr1659_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 1.06E-11 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 4.96E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 4.05E-09 mr1829_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 3.99E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 3.92E-06 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404303529 NA 2.29E-09 mr1902_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251