\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404256297:

Variant ID: vg0404256297 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 4256297
Reference Allele: AAlternative Allele: T,AT
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.06, others allele: 0.00, population size: 159. )

Flanking Sequence (100 bp) in Reference Genome:


AGGCTCCTATCCAAGGCATTTACTTTAAATGGTTGATGGAAATTTTAGCTCCCAGTCCATTCGATCTCCATCTTTTGAGTTTTCCAAAATATCCTAAAAA[A/T,AT]
TTTTTTTCAAAAGTTGGTTATTCCAAGTTGTTTGCCAAGAAAAGTTTCTCCATGAGAGGTCAATTTCTCTCAAGTCCAGATTGCTATATATGATTGCTTT

Reverse complement sequence

AAAGCAATCATATATAGCAATCTGGACTTGAGAGAAATTGACCTCTCATGGAGAAACTTTTCTTGGCAAACAACTTGGAATAACCAACTTTTGAAAAAAA[T/A,AT]
TTTTTAGGATATTTTGGAAAACTCAAAAGATGGAGATCGAATGGACTGGGAGCTAAAATTTCCATCAACCATTTAAAGTAAATGCCTTGGATAGGAGCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.20% 34.60% 0.17% 1.90% AT: 0.06%
All Indica  2759 86.80% 12.40% 0.18% 0.54% AT: 0.04%
All Japonica  1512 29.60% 70.00% 0.13% 0.20% AT: 0.07%
Aus  269 33.10% 42.40% 0.00% 24.54% NA
Indica I  595 95.30% 4.70% 0.00% 0.00% NA
Indica II  465 80.00% 19.80% 0.22% 0.00% NA
Indica III  913 89.20% 9.40% 0.33% 0.99% AT: 0.11%
Indica Intermediate  786 81.80% 17.30% 0.13% 0.76% NA
Temperate Japonica  767 41.70% 58.10% 0.00% 0.00% AT: 0.13%
Tropical Japonica  504 8.90% 91.10% 0.00% 0.00% NA
Japonica Intermediate  241 34.40% 63.50% 0.83% 1.24% NA
VI/Aromatic  96 10.40% 88.50% 0.00% 1.04% NA
Intermediate  90 51.10% 41.10% 1.11% 5.56% AT: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404256297 A -> DEL N N silent_mutation Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0404256297 A -> AT LOC_Os04g07990.1 upstream_gene_variant ; 2430.0bp to feature; MODIFIER silent_mutation Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0404256297 A -> AT LOC_Os04g07990-LOC_Os04g08010 intergenic_region ; MODIFIER silent_mutation Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0404256297 A -> T LOC_Os04g07990.1 upstream_gene_variant ; 2429.0bp to feature; MODIFIER silent_mutation Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N
vg0404256297 A -> T LOC_Os04g07990-LOC_Os04g08010 intergenic_region ; MODIFIER silent_mutation Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404256297 1.04E-06 3.09E-07 mr1035 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404256297 5.91E-06 3.08E-06 mr1626 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404256297 4.24E-06 4.24E-06 mr1035_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251