\
| Variant ID: vg0404256297 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr04 | Position: 4256297 |
| Reference Allele: A | Alternative Allele: T,AT |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, T: 0.06, others allele: 0.00, population size: 159. )
AGGCTCCTATCCAAGGCATTTACTTTAAATGGTTGATGGAAATTTTAGCTCCCAGTCCATTCGATCTCCATCTTTTGAGTTTTCCAAAATATCCTAAAAA[A/T,AT]
TTTTTTTCAAAAGTTGGTTATTCCAAGTTGTTTGCCAAGAAAAGTTTCTCCATGAGAGGTCAATTTCTCTCAAGTCCAGATTGCTATATATGATTGCTTT
AAAGCAATCATATATAGCAATCTGGACTTGAGAGAAATTGACCTCTCATGGAGAAACTTTTCTTGGCAAACAACTTGGAATAACCAACTTTTGAAAAAAA[T/A,AT]
TTTTTAGGATATTTTGGAAAACTCAAAAGATGGAGATCGAATGGACTGGGAGCTAAAATTTCCATCAACCATTTAAAGTAAATGCCTTGGATAGGAGCCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.20% | 34.60% | 0.17% | 1.90% | AT: 0.06% |
| All Indica | 2759 | 86.80% | 12.40% | 0.18% | 0.54% | AT: 0.04% |
| All Japonica | 1512 | 29.60% | 70.00% | 0.13% | 0.20% | AT: 0.07% |
| Aus | 269 | 33.10% | 42.40% | 0.00% | 24.54% | NA |
| Indica I | 595 | 95.30% | 4.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 80.00% | 19.80% | 0.22% | 0.00% | NA |
| Indica III | 913 | 89.20% | 9.40% | 0.33% | 0.99% | AT: 0.11% |
| Indica Intermediate | 786 | 81.80% | 17.30% | 0.13% | 0.76% | NA |
| Temperate Japonica | 767 | 41.70% | 58.10% | 0.00% | 0.00% | AT: 0.13% |
| Tropical Japonica | 504 | 8.90% | 91.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 34.40% | 63.50% | 0.83% | 1.24% | NA |
| VI/Aromatic | 96 | 10.40% | 88.50% | 0.00% | 1.04% | NA |
| Intermediate | 90 | 51.10% | 41.10% | 1.11% | 5.56% | AT: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404256297 | A -> DEL | N | N | silent_mutation | Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg0404256297 | A -> AT | LOC_Os04g07990.1 | upstream_gene_variant ; 2430.0bp to feature; MODIFIER | silent_mutation | Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg0404256297 | A -> AT | LOC_Os04g07990-LOC_Os04g08010 | intergenic_region ; MODIFIER | silent_mutation | Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg0404256297 | A -> T | LOC_Os04g07990.1 | upstream_gene_variant ; 2429.0bp to feature; MODIFIER | silent_mutation | Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| vg0404256297 | A -> T | LOC_Os04g07990-LOC_Os04g08010 | intergenic_region ; MODIFIER | silent_mutation | Average:47.839; most accessible tissue: Minghui63 young leaf, score: 62.741 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404256297 | 1.04E-06 | 3.09E-07 | mr1035 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404256297 | 5.91E-06 | 3.08E-06 | mr1626 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404256297 | 4.24E-06 | 4.24E-06 | mr1035_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |