Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0404220455:

Variant ID: vg0404220455 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4220455
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:

CTTATGAGTTATGTTAAAATAGATATTCAATAGGTAAAATATTAGCAGCATGATTTATTATTTCAATCAAAATAAAACAAAATCAAAGATGTCTTGAATT[C/T]
GGCACATAGAACATGCAAGTTTTGACATAATACATATGATCAGAATGTCTTGAATAGAAGGTGCAAATTCGACGATACCTGTGTACATTACAGACAATCG

Reverse complement sequence

CGATTGTCTGTAATGTACACAGGTATCGTCGAATTTGCACCTTCTATTCAAGACATTCTGATCATATGTATTATGTCAAAACTTGCATGTTCTATGTGCC[G/A]
AATTCAAGACATCTTTGATTTTGTTTTATTTTGATTGAAATAATAAATCATGCTGCTAATATTTTACCTATTGAATATCTATTTTAACATAACTCATAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.10%	15.20%	0.17%	1.48%	NA
All Indica	2759	75.40%	24.00%	0.11%	0.47%	NA
All Japonica	1512	99.70%	0.30%	0.07%	0.00%	NA
Aus	269	63.60%	14.90%	1.49%	20.07%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	83.00%	17.00%	0.00%	0.00%	NA
Indica III	913	53.60%	45.60%	0.22%	0.66%	NA
Indica Intermediate	786	77.90%	21.10%	0.13%	0.89%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	86.70%	10.00%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404220455	C -> DEL	N	N	silent_mutation	Average:30.263; most accessible tissue: Callus, score: 59.148	N	N	N	N
vg0404220455	C -> T	LOC_Os04g07900.1	upstream_gene_variant ; 1371.0bp to feature; MODIFIER	silent_mutation	Average:30.263; most accessible tissue: Callus, score: 59.148	N	N	N	N
vg0404220455	C -> T	LOC_Os04g07890.1	downstream_gene_variant ; 1873.0bp to feature; MODIFIER	silent_mutation	Average:30.263; most accessible tissue: Callus, score: 59.148	N	N	N	N
vg0404220455	C -> T	LOC_Os04g07910.1	downstream_gene_variant ; 385.0bp to feature; MODIFIER	silent_mutation	Average:30.263; most accessible tissue: Callus, score: 59.148	N	N	N	N
vg0404220455	C -> T	LOC_Os04g07900-LOC_Os04g07910	intergenic_region ; MODIFIER	silent_mutation	Average:30.263; most accessible tissue: Callus, score: 59.148	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404220455	8.82E-06	NA	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404220455	2.84E-06	8.19E-06	mr1612_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404220455	NA	6.11E-06	mr1698_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404220455	4.94E-06	2.12E-06	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251