\
| Variant ID: vg0404220455 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4220455 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 116. )
CTTATGAGTTATGTTAAAATAGATATTCAATAGGTAAAATATTAGCAGCATGATTTATTATTTCAATCAAAATAAAACAAAATCAAAGATGTCTTGAATT[C/T]
GGCACATAGAACATGCAAGTTTTGACATAATACATATGATCAGAATGTCTTGAATAGAAGGTGCAAATTCGACGATACCTGTGTACATTACAGACAATCG
CGATTGTCTGTAATGTACACAGGTATCGTCGAATTTGCACCTTCTATTCAAGACATTCTGATCATATGTATTATGTCAAAACTTGCATGTTCTATGTGCC[G/A]
AATTCAAGACATCTTTGATTTTGTTTTATTTTGATTGAAATAATAAATCATGCTGCTAATATTTTACCTATTGAATATCTATTTTAACATAACTCATAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.10% | 15.20% | 0.17% | 1.48% | NA |
| All Indica | 2759 | 75.40% | 24.00% | 0.11% | 0.47% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 63.60% | 14.90% | 1.49% | 20.07% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 83.00% | 17.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 53.60% | 45.60% | 0.22% | 0.66% | NA |
| Indica Intermediate | 786 | 77.90% | 21.10% | 0.13% | 0.89% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.40% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 86.70% | 10.00% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404220455 | C -> DEL | N | N | silent_mutation | Average:30.263; most accessible tissue: Callus, score: 59.148 | N | N | N | N |
| vg0404220455 | C -> T | LOC_Os04g07900.1 | upstream_gene_variant ; 1371.0bp to feature; MODIFIER | silent_mutation | Average:30.263; most accessible tissue: Callus, score: 59.148 | N | N | N | N |
| vg0404220455 | C -> T | LOC_Os04g07890.1 | downstream_gene_variant ; 1873.0bp to feature; MODIFIER | silent_mutation | Average:30.263; most accessible tissue: Callus, score: 59.148 | N | N | N | N |
| vg0404220455 | C -> T | LOC_Os04g07910.1 | downstream_gene_variant ; 385.0bp to feature; MODIFIER | silent_mutation | Average:30.263; most accessible tissue: Callus, score: 59.148 | N | N | N | N |
| vg0404220455 | C -> T | LOC_Os04g07900-LOC_Os04g07910 | intergenic_region ; MODIFIER | silent_mutation | Average:30.263; most accessible tissue: Callus, score: 59.148 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404220455 | 8.82E-06 | NA | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404220455 | 2.84E-06 | 8.19E-06 | mr1612_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404220455 | NA | 6.11E-06 | mr1698_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404220455 | 4.94E-06 | 2.12E-06 | mr1726_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |