\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404220455:

Variant ID: vg0404220455 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4220455
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 116. )

Flanking Sequence (100 bp) in Reference Genome:


CTTATGAGTTATGTTAAAATAGATATTCAATAGGTAAAATATTAGCAGCATGATTTATTATTTCAATCAAAATAAAACAAAATCAAAGATGTCTTGAATT[C/T]
GGCACATAGAACATGCAAGTTTTGACATAATACATATGATCAGAATGTCTTGAATAGAAGGTGCAAATTCGACGATACCTGTGTACATTACAGACAATCG

Reverse complement sequence

CGATTGTCTGTAATGTACACAGGTATCGTCGAATTTGCACCTTCTATTCAAGACATTCTGATCATATGTATTATGTCAAAACTTGCATGTTCTATGTGCC[G/A]
AATTCAAGACATCTTTGATTTTGTTTTATTTTGATTGAAATAATAAATCATGCTGCTAATATTTTACCTATTGAATATCTATTTTAACATAACTCATAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.10% 15.20% 0.17% 1.48% NA
All Indica  2759 75.40% 24.00% 0.11% 0.47% NA
All Japonica  1512 99.70% 0.30% 0.07% 0.00% NA
Aus  269 63.60% 14.90% 1.49% 20.07% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 83.00% 17.00% 0.00% 0.00% NA
Indica III  913 53.60% 45.60% 0.22% 0.66% NA
Indica Intermediate  786 77.90% 21.10% 0.13% 0.89% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 86.70% 10.00% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404220455 C -> DEL N N silent_mutation Average:30.263; most accessible tissue: Callus, score: 59.148 N N N N
vg0404220455 C -> T LOC_Os04g07900.1 upstream_gene_variant ; 1371.0bp to feature; MODIFIER silent_mutation Average:30.263; most accessible tissue: Callus, score: 59.148 N N N N
vg0404220455 C -> T LOC_Os04g07890.1 downstream_gene_variant ; 1873.0bp to feature; MODIFIER silent_mutation Average:30.263; most accessible tissue: Callus, score: 59.148 N N N N
vg0404220455 C -> T LOC_Os04g07910.1 downstream_gene_variant ; 385.0bp to feature; MODIFIER silent_mutation Average:30.263; most accessible tissue: Callus, score: 59.148 N N N N
vg0404220455 C -> T LOC_Os04g07900-LOC_Os04g07910 intergenic_region ; MODIFIER silent_mutation Average:30.263; most accessible tissue: Callus, score: 59.148 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404220455 8.82E-06 NA mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404220455 2.84E-06 8.19E-06 mr1612_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404220455 NA 6.11E-06 mr1698_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404220455 4.94E-06 2.12E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251