\
| Variant ID: vg0404027324 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4027324 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.92, A: 0.07, others allele: 0.00, population size: 218. )
GTAGTGGAGGGGTAAACCGAGGTAGCGGCAGGGGAACTGTTTTATCATGCTTGGGAAATTCGCGAGAAGAGAAACGAGGTTTATTTCTTCACACCTGATC[G/A]
GGTAGATCTTTGTTTTGCTGACATTTGTGTGAAGACCCGAGACTTGTGCGAAAAAGACTAAGAGCTGCACAAGCATCGATAAATCAATAGGCTGAGGTTT
AAACCTCAGCCTATTGATTTATCGATGCTTGTGCAGCTCTTAGTCTTTTTCGCACAAGTCTCGGGTCTTCACACAAATGTCAGCAAAACAAAGATCTACC[C/T]
GATCAGGTGTGAAGAAATAAACCTCGTTTCTCTTCTCGCGAATTTCCCAAGCATGATAAAACAGTTCCCCTGCCGCTACCTCGGTTTACCCCTCCACTAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.00% | 28.50% | 0.47% | 20.06% | NA |
| All Indica | 2759 | 31.00% | 39.10% | 0.62% | 29.29% | NA |
| All Japonica | 1512 | 93.80% | 1.70% | 0.07% | 4.37% | NA |
| Aus | 269 | 27.90% | 49.40% | 1.49% | 21.19% | NA |
| Indica I | 595 | 53.60% | 5.40% | 0.50% | 40.50% | NA |
| Indica II | 465 | 37.40% | 31.60% | 0.65% | 30.32% | NA |
| Indica III | 913 | 12.80% | 65.40% | 0.55% | 21.25% | NA |
| Indica Intermediate | 786 | 31.30% | 38.40% | 0.76% | 29.52% | NA |
| Temperate Japonica | 767 | 99.60% | 0.30% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 85.50% | 3.60% | 0.20% | 10.71% | NA |
| Japonica Intermediate | 241 | 92.90% | 2.50% | 0.00% | 4.56% | NA |
| VI/Aromatic | 96 | 11.50% | 86.50% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 52.20% | 31.10% | 0.00% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404027324 | G -> DEL | N | N | silent_mutation | Average:32.905; most accessible tissue: Callus, score: 63.721 | N | N | N | N |
| vg0404027324 | G -> A | LOC_Os04g07570.1 | downstream_gene_variant ; 1644.0bp to feature; MODIFIER | silent_mutation | Average:32.905; most accessible tissue: Callus, score: 63.721 | N | N | N | N |
| vg0404027324 | G -> A | LOC_Os04g07580.1 | downstream_gene_variant ; 379.0bp to feature; MODIFIER | silent_mutation | Average:32.905; most accessible tissue: Callus, score: 63.721 | N | N | N | N |
| vg0404027324 | G -> A | LOC_Os04g07570-LOC_Os04g07580 | intergenic_region ; MODIFIER | silent_mutation | Average:32.905; most accessible tissue: Callus, score: 63.721 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404027324 | 2.26E-07 | 6.39E-06 | mr1035 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404027324 | 1.87E-06 | NA | mr1626 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404027324 | NA | 6.13E-08 | mr1915 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |