\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404020832:

Variant ID: vg0404020832 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 4020832
Reference Allele: AAlternative Allele: G,ACGACCG,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.04, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


AACCACTACTTCGCTCTCCCGAGAAGGGAGAACGGAAACAGTCGCAGCCTGACGACGTCGGGACTGACGCCCTTGATGGTGTACGTGCTATAGATCTCTA[A/G,ACGACCG,C]
GAACTGTTGCAGATGAGCATTGGCATCCTCATTAGGCTTGCCACAGAACGGGTTAGCCTGCGCCATCGTGATGAGGCTGGACTTCAAGTCGAAATCCATG

Reverse complement sequence

CATGGATTTCGACTTGAAGTCCAGCCTCATCACGATGGCGCAGGCTAACCCGTTCTGTGGCAAGCCTAATGAGGATGCCAATGCTCATCTGCAACAGTTC[T/C,CGGTCGT,G]
TAGAGATCTATAGCACGTACACCATCAAGGGCGTCAGTCCCGACGTCGTCAGGCTGCGACTGTTTCCGTTCTCCCTTCTCGGGAGAGCGAAGTAGTGGTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.70% 16.00% 9.18% 38.81% C: 0.19%; ACGACCG: 0.15%
All Indica  2759 20.30% 11.30% 12.43% 55.42% C: 0.33%; ACGACCG: 0.25%
All Japonica  1512 68.30% 25.20% 1.12% 5.36% NA
Aus  269 20.10% 11.50% 16.73% 51.67% NA
Indica I  595 20.00% 30.10% 9.92% 39.50% C: 0.34%; ACGACCG: 0.17%
Indica II  465 27.30% 10.50% 10.11% 51.83% ACGACCG: 0.22%
Indica III  913 13.80% 1.60% 14.35% 69.33% C: 0.44%; ACGACCG: 0.44%
Indica Intermediate  786 23.80% 8.80% 13.49% 53.44% C: 0.38%; ACGACCG: 0.13%
Temperate Japonica  767 59.50% 40.20% 0.00% 0.39% NA
Tropical Japonica  504 75.40% 9.10% 2.58% 12.90% NA
Japonica Intermediate  241 81.70% 11.20% 1.66% 5.39% NA
VI/Aromatic  96 12.50% 16.70% 17.71% 53.12% NA
Intermediate  90 33.30% 15.60% 13.33% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404020832 A -> C LOC_Os04g07560.1 missense_variant ; p.Leu108Val; MODERATE nonsynonymous_codon ; L108V Average:41.619; most accessible tissue: Minghui63 young leaf, score: 84.596 benign 0.523 TOLERATED 0.10
vg0404020832 A -> DEL LOC_Os04g07560.1 N frameshift_variant Average:41.619; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0404020832 A -> ACGACCG LOC_Os04g07560.1 inframe_insertion ; p.Phe107_Leu108insArgSer; MODERATE inframe_variant Average:41.619; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N
vg0404020832 A -> G LOC_Os04g07560.1 synonymous_variant ; p.Leu108Leu; LOW synonymous_codon Average:41.619; most accessible tissue: Minghui63 young leaf, score: 84.596 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0404020832 A ACGAC* 0.09 0.07 0.05 0.07 0.06 0.07
vg0404020832 A C 0.01 0.01 0.01 0.0 0.0 0.0
vg0404020832 A G 0.0 0.0 0.0 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404020832 3.67E-06 3.57E-07 mr1355_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251