\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404020437:

Variant ID: vg0404020437 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4020437
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTCCTTGACGGTGTGCATGCCTCGCTAACGGGTCTGGAGTCGTTCCTCGCTCCAACCCATATTGGAGACCATCTTCTCTATTAGATCAACGGCTCCTTG[A/C]
ACCGTTTTAGAGAAGAATGCTCCTCCAGCTGCCGCGTCCAGGTGATCTCGGGACATCGGGGTGAGTCCGTTATAAAAGTTCTGCAGGATCAGCCAGTCAT

Reverse complement sequence

ATGACTGGCTGATCCTGCAGAACTTTTATAACGGACTCACCCCGATGTCCCGAGATCACCTGGACGCGGCAGCTGGAGGAGCATTCTTCTCTAAAACGGT[T/G]
CAAGGAGCCGTTGATCTAATAGAGAAGATGGTCTCCAATATGGGTTGGAGCGAGGAACGACTCCAGACCCGTTAGCGAGGCATGCACACCGTCAAGGAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 4.40% 4.19% 0.21% NA
All Indica  2759 85.20% 7.40% 7.00% 0.36% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 89.20% 5.00% 5.71% 0.00% NA
Indica II  465 81.10% 8.00% 10.32% 0.65% NA
Indica III  913 82.30% 10.60% 7.01% 0.11% NA
Indica Intermediate  786 88.20% 5.10% 5.98% 0.76% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 95.60% 1.10% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404020437 A -> C LOC_Os04g07550.1 upstream_gene_variant ; 82.0bp to feature; MODIFIER silent_mutation Average:45.41; most accessible tissue: Minghui63 flag leaf, score: 79.383 N N N N
vg0404020437 A -> C LOC_Os04g07570.1 upstream_gene_variant ; 3316.0bp to feature; MODIFIER silent_mutation Average:45.41; most accessible tissue: Minghui63 flag leaf, score: 79.383 N N N N
vg0404020437 A -> C LOC_Os04g07560.1 downstream_gene_variant ; 300.0bp to feature; MODIFIER silent_mutation Average:45.41; most accessible tissue: Minghui63 flag leaf, score: 79.383 N N N N
vg0404020437 A -> C LOC_Os04g07550-LOC_Os04g07560 intergenic_region ; MODIFIER silent_mutation Average:45.41; most accessible tissue: Minghui63 flag leaf, score: 79.383 N N N N
vg0404020437 A -> DEL N N silent_mutation Average:45.41; most accessible tissue: Minghui63 flag leaf, score: 79.383 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404020437 NA 2.90E-06 mr1089 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020437 NA 1.73E-07 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020437 NA 1.54E-07 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020437 2.50E-07 NA mr1251 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020437 1.95E-06 2.00E-07 mr1251 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020437 1.83E-06 NA mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020437 NA 9.97E-07 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020437 NA 1.67E-06 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020437 NA 5.31E-06 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020437 4.40E-07 NA mr1435 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020437 1.00E-06 1.98E-07 mr1435 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020437 NA 7.49E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404020437 NA 2.48E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251