\
| Variant ID: vg0404020437 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 4020437 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TCTCCTTGACGGTGTGCATGCCTCGCTAACGGGTCTGGAGTCGTTCCTCGCTCCAACCCATATTGGAGACCATCTTCTCTATTAGATCAACGGCTCCTTG[A/C]
ACCGTTTTAGAGAAGAATGCTCCTCCAGCTGCCGCGTCCAGGTGATCTCGGGACATCGGGGTGAGTCCGTTATAAAAGTTCTGCAGGATCAGCCAGTCAT
ATGACTGGCTGATCCTGCAGAACTTTTATAACGGACTCACCCCGATGTCCCGAGATCACCTGGACGCGGCAGCTGGAGGAGCATTCTTCTCTAAAACGGT[T/G]
CAAGGAGCCGTTGATCTAATAGAGAAGATGGTCTCCAATATGGGTTGGAGCGAGGAACGACTCCAGACCCGTTAGCGAGGCATGCACACCGTCAAGGAGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.20% | 4.40% | 4.19% | 0.21% | NA |
| All Indica | 2759 | 85.20% | 7.40% | 7.00% | 0.36% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.07% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 89.20% | 5.00% | 5.71% | 0.00% | NA |
| Indica II | 465 | 81.10% | 8.00% | 10.32% | 0.65% | NA |
| Indica III | 913 | 82.30% | 10.60% | 7.01% | 0.11% | NA |
| Indica Intermediate | 786 | 88.20% | 5.10% | 5.98% | 0.76% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 1.10% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0404020437 | A -> C | LOC_Os04g07550.1 | upstream_gene_variant ; 82.0bp to feature; MODIFIER | silent_mutation | Average:45.41; most accessible tissue: Minghui63 flag leaf, score: 79.383 | N | N | N | N |
| vg0404020437 | A -> C | LOC_Os04g07570.1 | upstream_gene_variant ; 3316.0bp to feature; MODIFIER | silent_mutation | Average:45.41; most accessible tissue: Minghui63 flag leaf, score: 79.383 | N | N | N | N |
| vg0404020437 | A -> C | LOC_Os04g07560.1 | downstream_gene_variant ; 300.0bp to feature; MODIFIER | silent_mutation | Average:45.41; most accessible tissue: Minghui63 flag leaf, score: 79.383 | N | N | N | N |
| vg0404020437 | A -> C | LOC_Os04g07550-LOC_Os04g07560 | intergenic_region ; MODIFIER | silent_mutation | Average:45.41; most accessible tissue: Minghui63 flag leaf, score: 79.383 | N | N | N | N |
| vg0404020437 | A -> DEL | N | N | silent_mutation | Average:45.41; most accessible tissue: Minghui63 flag leaf, score: 79.383 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0404020437 | NA | 2.90E-06 | mr1089 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020437 | NA | 1.73E-07 | mr1109 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020437 | NA | 1.54E-07 | mr1129 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020437 | 2.50E-07 | NA | mr1251 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020437 | 1.95E-06 | 2.00E-07 | mr1251 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020437 | 1.83E-06 | NA | mr1255 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020437 | NA | 9.97E-07 | mr1255 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020437 | NA | 1.67E-06 | mr1257 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020437 | NA | 5.31E-06 | mr1423 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020437 | 4.40E-07 | NA | mr1435 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020437 | 1.00E-06 | 1.98E-07 | mr1435 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020437 | NA | 7.49E-07 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0404020437 | NA | 2.48E-06 | mr1236_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |