Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404017804:

Variant ID: vg0404017804 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4017804
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TACGCTTGAAGGTCATCGTGCTGTTGCTGCATCATGTTCTTGAAGTTGGCGTACTGAGCATCAGCAGATTATTGCCATTCTTGCGTTTGTGCTATGTGTT[A/C]
CGAGAGGTTGTATTGGATCTCCCCCATCTGCACATCAAGGGTGTCCATTCTCCTAGTGATTTCACCCAAGTCCCAACGAGAGGAACATGAGCGCCATTCA

Reverse complement sequence

TGAATGGCGCTCATGTTCCTCTCGTTGGGACTTGGGTGAAATCACTAGGAGAATGGACACCCTTGATGTGCAGATGGGGGAGATCCAATACAACCTCTCG[T/G]
AACACATAGCACAAACGCAAGAATGGCAATAATCTGCTGATGCTCAGTACGCCAACTTCAAGAACATGATGCAGCAACAGCACGATGACCTTCAAGCGTA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.80%	1.10%	3.77%	36.33%	NA
All Indica	2759	36.80%	1.80%	6.09%	55.24%	NA
All Japonica	1512	95.20%	0.00%	0.26%	4.56%	NA
Aus	269	62.50%	0.00%	1.49%	36.06%	NA
Indica I	595	54.10%	0.00%	6.05%	39.83%	NA
Indica II	465	50.50%	5.20%	4.73%	39.57%	NA
Indica III	913	16.50%	1.30%	6.90%	75.25%	NA
Indica Intermediate	786	39.20%	1.90%	5.98%	52.93%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	88.70%	0.00%	0.60%	10.71%	NA
Japonica Intermediate	241	93.80%	0.00%	0.41%	5.81%	NA
VI/Aromatic	96	97.90%	0.00%	1.04%	1.04%	NA
Intermediate	90	70.00%	0.00%	1.11%	28.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404017804	A -> C	LOC_Os04g07550.1	downstream_gene_variant ; 1170.0bp to feature; MODIFIER	silent_mutation	Average:36.658; most accessible tissue: Minghui63 young leaf, score: 72.408	N	N	N	N
vg0404017804	A -> C	LOC_Os04g07560.1	downstream_gene_variant ; 2933.0bp to feature; MODIFIER	silent_mutation	Average:36.658; most accessible tissue: Minghui63 young leaf, score: 72.408	N	N	N	N
vg0404017804	A -> C	LOC_Os04g07540-LOC_Os04g07550	intergenic_region ; MODIFIER	silent_mutation	Average:36.658; most accessible tissue: Minghui63 young leaf, score: 72.408	N	N	N	N
vg0404017804	A -> DEL	N	N	silent_mutation	Average:36.658; most accessible tissue: Minghui63 young leaf, score: 72.408	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404017804	8.23E-06	NA	mr1109	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	3.28E-11	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	8.76E-09	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	7.38E-07	NA	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	1.33E-06	3.85E-08	mr1251	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	8.60E-18	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	1.39E-07	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	1.08E-08	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	4.63E-07	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	2.03E-07	mr1435	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	2.40E-11	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	3.13E-09	mr1129_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	2.35E-08	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	2.59E-09	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	5.49E-07	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	9.37E-06	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	1.39E-07	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	3.44E-09	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804	NA	5.89E-07	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251