\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404017804:

Variant ID: vg0404017804 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 4017804
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


TACGCTTGAAGGTCATCGTGCTGTTGCTGCATCATGTTCTTGAAGTTGGCGTACTGAGCATCAGCAGATTATTGCCATTCTTGCGTTTGTGCTATGTGTT[A/C]
CGAGAGGTTGTATTGGATCTCCCCCATCTGCACATCAAGGGTGTCCATTCTCCTAGTGATTTCACCCAAGTCCCAACGAGAGGAACATGAGCGCCATTCA

Reverse complement sequence

TGAATGGCGCTCATGTTCCTCTCGTTGGGACTTGGGTGAAATCACTAGGAGAATGGACACCCTTGATGTGCAGATGGGGGAGATCCAATACAACCTCTCG[T/G]
AACACATAGCACAAACGCAAGAATGGCAATAATCTGCTGATGCTCAGTACGCCAACTTCAAGAACATGATGCAGCAACAGCACGATGACCTTCAAGCGTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.80% 1.10% 3.77% 36.33% NA
All Indica  2759 36.80% 1.80% 6.09% 55.24% NA
All Japonica  1512 95.20% 0.00% 0.26% 4.56% NA
Aus  269 62.50% 0.00% 1.49% 36.06% NA
Indica I  595 54.10% 0.00% 6.05% 39.83% NA
Indica II  465 50.50% 5.20% 4.73% 39.57% NA
Indica III  913 16.50% 1.30% 6.90% 75.25% NA
Indica Intermediate  786 39.20% 1.90% 5.98% 52.93% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 88.70% 0.00% 0.60% 10.71% NA
Japonica Intermediate  241 93.80% 0.00% 0.41% 5.81% NA
VI/Aromatic  96 97.90% 0.00% 1.04% 1.04% NA
Intermediate  90 70.00% 0.00% 1.11% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0404017804 A -> C LOC_Os04g07550.1 downstream_gene_variant ; 1170.0bp to feature; MODIFIER silent_mutation Average:36.658; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg0404017804 A -> C LOC_Os04g07560.1 downstream_gene_variant ; 2933.0bp to feature; MODIFIER silent_mutation Average:36.658; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg0404017804 A -> C LOC_Os04g07540-LOC_Os04g07550 intergenic_region ; MODIFIER silent_mutation Average:36.658; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N
vg0404017804 A -> DEL N N silent_mutation Average:36.658; most accessible tissue: Minghui63 young leaf, score: 72.408 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0404017804 8.23E-06 NA mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 3.28E-11 mr1109 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 8.76E-09 mr1129 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 7.38E-07 NA mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 1.33E-06 3.85E-08 mr1251 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 8.60E-18 mr1255 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 1.39E-07 mr1255 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 1.08E-08 mr1257 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 4.63E-07 mr1423 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 2.03E-07 mr1435 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 2.40E-11 mr1109_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 3.13E-09 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 2.35E-08 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 2.59E-09 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 5.49E-07 mr1251_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 9.37E-06 mr1253_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 1.39E-07 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 3.44E-09 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404017804 NA 5.89E-07 mr1435_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251