Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0404016759:

Variant ID: vg0404016759 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4016759
Reference Allele: T	Alternative Allele: A,G
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CACATTTATTACTAAGTCAAAAGCTTAGACTAAAGCAGAAAACTAAACATACTCAAGATCAAGATCATGCAATGTGTGTGTGATATATGGTGGAAATGGT[T/A,G]
TATGAAGGAAAATAAAGAAAATGCTTCTCCTTTGTGCCTACTTCATTCTCCCAAAAATCCTTCTTTTATTGATTAGGAGAGGGCATGATTACATTTTTCT

Reverse complement sequence

AGAAAAATGTAATCATGCCCTCTCCTAATCAATAAAAGAAGGATTTTTGGGAGAATGAAGTAGGCACAAAGGAGAAGCATTTTCTTTATTTTCCTTCATA[A/T,C]
ACCATTTCCACCATATATCACACACACATTGCATGATCTTGATCTTGAGTATGTTTAGTTTTCTGCTTTAGTCTAAGCTTTTGACTTAGTAATAAATGTG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.30%	0.90%	2.60%	31.15%	G: 0.02%
All Indica	2759	47.60%	0.60%	3.70%	48.13%	G: 0.04%
All Japonica	1512	95.40%	0.00%	0.33%	4.23%	NA
Aus	269	65.10%	8.90%	5.20%	20.82%	NA
Indica I	595	65.00%	0.20%	2.86%	31.93%	NA
Indica II	465	59.10%	0.00%	3.01%	37.85%	NA
Indica III	913	29.60%	0.30%	4.49%	65.61%	NA
Indica Intermediate	786	48.30%	1.50%	3.82%	46.18%	G: 0.13%
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	89.50%	0.00%	0.99%	9.52%	NA
Japonica Intermediate	241	93.80%	0.00%	0.00%	6.22%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	71.10%	2.20%	2.22%	24.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404016759	T -> G	LOC_Os04g07540.1	downstream_gene_variant ; 4214.0bp to feature; MODIFIER	silent_mutation	Average:19.333; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N
vg0404016759	T -> G	LOC_Os04g07550.1	downstream_gene_variant ; 2215.0bp to feature; MODIFIER	silent_mutation	Average:19.333; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N
vg0404016759	T -> G	LOC_Os04g07560.1	downstream_gene_variant ; 3978.0bp to feature; MODIFIER	silent_mutation	Average:19.333; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N
vg0404016759	T -> G	LOC_Os04g07540-LOC_Os04g07550	intergenic_region ; MODIFIER	silent_mutation	Average:19.333; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N
vg0404016759	T -> DEL	N	N	silent_mutation	Average:19.333; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N
vg0404016759	T -> A	LOC_Os04g07540.1	downstream_gene_variant ; 4214.0bp to feature; MODIFIER	silent_mutation	Average:19.333; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N
vg0404016759	T -> A	LOC_Os04g07550.1	downstream_gene_variant ; 2215.0bp to feature; MODIFIER	silent_mutation	Average:19.333; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N
vg0404016759	T -> A	LOC_Os04g07560.1	downstream_gene_variant ; 3978.0bp to feature; MODIFIER	silent_mutation	Average:19.333; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N
vg0404016759	T -> A	LOC_Os04g07540-LOC_Os04g07550	intergenic_region ; MODIFIER	silent_mutation	Average:19.333; most accessible tissue: Zhenshan97 young leaf, score: 41.875	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404016759	4.64E-06	NA	mr1730_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251