Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0404016698:

Variant ID: vg0404016698 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 4016698
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, T: 0.00, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:

TCCTACTCTAAGGTTTTAATATGTGGAGCTCGGCAGGGATCAAACATGGAATACATGCATTCACATTTATTACTAAGTCAAAAGCTTAGACTAAAGCAGA[A/T]
AACTAAACATACTCAAGATCAAGATCATGCAATGTGTGTGTGATATATGGTGGAAATGGTTTATGAAGGAAAATAAAGAAAATGCTTCTCCTTTGTGCCT

Reverse complement sequence

AGGCACAAAGGAGAAGCATTTTCTTTATTTTCCTTCATAAACCATTTCCACCATATATCACACACACATTGCATGATCTTGATCTTGAGTATGTTTAGTT[T/A]
TCTGCTTTAGTCTAAGCTTTTGACTTAGTAATAAATGTGAATGCATGTATTCCATGTTTGATCCCTGCCGAGCTCCACATATTAAAACCTTAGAGTAGGA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.30%	1.10%	1.04%	39.61%	NA
All Indica	2759	35.90%	1.80%	1.52%	60.78%	NA
All Japonica	1512	95.20%	0.00%	0.26%	4.56%	NA
Aus	269	63.20%	0.00%	0.74%	36.06%	NA
Indica I	595	53.60%	0.00%	1.51%	44.87%	NA
Indica II	465	48.80%	5.20%	2.37%	43.66%	NA
Indica III	913	15.20%	1.20%	1.86%	81.71%	NA
Indica Intermediate	786	38.80%	1.90%	0.64%	58.65%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	88.50%	0.00%	0.60%	10.91%	NA
Japonica Intermediate	241	94.20%	0.00%	0.41%	5.39%	NA
VI/Aromatic	96	97.90%	0.00%	0.00%	2.08%	NA
Intermediate	90	68.90%	0.00%	1.11%	30.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0404016698	A -> DEL	N	N	silent_mutation	Average:19.862; most accessible tissue: Zhenshan97 young leaf, score: 44.598	N	N	N	N
vg0404016698	A -> T	LOC_Os04g07540.1	downstream_gene_variant ; 4153.0bp to feature; MODIFIER	silent_mutation	Average:19.862; most accessible tissue: Zhenshan97 young leaf, score: 44.598	N	N	N	N
vg0404016698	A -> T	LOC_Os04g07550.1	downstream_gene_variant ; 2276.0bp to feature; MODIFIER	silent_mutation	Average:19.862; most accessible tissue: Zhenshan97 young leaf, score: 44.598	N	N	N	N
vg0404016698	A -> T	LOC_Os04g07560.1	downstream_gene_variant ; 4039.0bp to feature; MODIFIER	silent_mutation	Average:19.862; most accessible tissue: Zhenshan97 young leaf, score: 44.598	N	N	N	N
vg0404016698	A -> T	LOC_Os04g07540-LOC_Os04g07550	intergenic_region ; MODIFIER	silent_mutation	Average:19.862; most accessible tissue: Zhenshan97 young leaf, score: 44.598	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0404016698	NA	1.62E-08	mr1109	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	3.94E-06	NA	mr1129	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	5.50E-06	1.39E-09	mr1129	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	NA	4.51E-06	mr1251	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	NA	8.78E-19	mr1255	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	NA	9.03E-08	mr1255	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	NA	3.88E-08	mr1257	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	NA	1.54E-07	mr1423	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	8.14E-07	NA	mr1435	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	4.06E-07	3.88E-08	mr1435	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	NA	3.44E-10	mr1109_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	4.17E-06	7.02E-11	mr1129_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	NA	2.74E-07	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	NA	4.01E-08	mr1236_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	7.24E-06	2.43E-08	mr1251_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	NA	2.49E-06	mr1253_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	NA	1.94E-20	mr1255_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	NA	6.92E-09	mr1255_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	NA	2.32E-10	mr1257_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	NA	8.49E-07	mr1423_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	7.46E-06	2.63E-08	mr1435_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0404016698	6.10E-06	4.64E-08	mr1599_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251