Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403922728:

Variant ID: vg0403922728 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3922728
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:

TGTATTTCAAACTCTTATGATCGGTATATATTTCACAGCGATTCCCAATGAGATAGTGCCGCCAGATTTTTAGAGCATGAACCACCGCGGCTAACTCCAA[G/A]
TCATGGGTAGGGTAGTTGCATTCATGGGGCCGTAGCTGGCGTGAGGCATAGGCCACCACATGACCGTCCTGCATGAGCACGCACCCCAATCCTTGGCGCG

Reverse complement sequence

CGCGCCAAGGATTGGGGTGCGTGCTCATGCAGGACGGTCATGTGGTGGCCTATGCCTCACGCCAGCTACGGCCCCATGAATGCAACTACCCTACCCATGA[C/T]
TTGGAGTTAGCCGCGGTGGTTCATGCTCTAAAAATCTGGCGGCACTATCTCATTGGGAATCGCTGTGAAATATATACCGATCATAAGAGTTTGAAATACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.80%	2.20%	5.29%	20.72%	NA
All Indica	2759	73.30%	0.10%	5.11%	21.49%	NA
All Japonica	1512	69.90%	6.70%	3.90%	19.44%	NA
Aus	269	66.90%	0.00%	8.18%	24.91%	NA
Indica I	595	56.60%	0.20%	7.56%	35.63%	NA
Indica II	465	57.00%	0.40%	6.67%	35.91%	NA
Indica III	913	93.40%	0.00%	1.53%	5.04%	NA
Indica Intermediate	786	72.10%	0.00%	6.49%	21.37%	NA
Temperate Japonica	767	92.80%	0.30%	0.52%	6.39%	NA
Tropical Japonica	504	39.30%	16.90%	9.33%	34.52%	NA
Japonica Intermediate	241	61.00%	6.20%	3.32%	29.46%	NA
VI/Aromatic	96	65.60%	0.00%	22.92%	11.46%	NA
Intermediate	90	76.70%	1.10%	6.67%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403922728	G -> DEL	LOC_Os04g07370.1	N	frameshift_variant	Average:35.921; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N
vg0403922728	G -> A	LOC_Os04g07370.1	synonymous_variant ; p.Asp1151Asp; LOW	synonymous_codon	Average:35.921; most accessible tissue: Minghui63 young leaf, score: 79.191	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403922728	3.96E-07	3.96E-07	mr1068	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	NA	2.14E-06	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	5.49E-06	NA	mr1090	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	4.88E-06	9.35E-09	mr1090	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	NA	6.16E-07	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	NA	3.95E-06	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	3.67E-06	3.67E-06	mr1110	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	NA	7.78E-09	mr1121	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	9.30E-08	NA	mr1211	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	NA	7.91E-07	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	NA	2.16E-07	mr1068_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	NA	2.07E-06	mr1078_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	7.97E-06	1.94E-09	mr1090_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	NA	7.14E-07	mr1094_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	NA	1.86E-07	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	3.33E-06	4.43E-08	mr1110_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	4.95E-06	4.95E-06	mr1111_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	NA	4.61E-07	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	NA	2.05E-08	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922728	1.43E-06	1.41E-09	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251