RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0403922278:

Variant ID: vg0403922278 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3922278
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGGATGGAATAAGGACTTTCGTGAGCTTCCTGAAGTATCAGCTGTTTAAGTTCTCTGTTATCTGGAACGCATACTCGATTTCCGTTCCATAGGGTTCC[G/A]
TGTTCATCCTCTGTGAAACCCGCAGCTTTACCCTGTTTCATATTTTTGAGGAGTCCACGCATGTCCGGGTCGTTCCTCTGAGCCTCGCGGATTTGATCGA

Reverse complement sequence

TCGATCAAATCCGCGAGGCTCAGAGGAACGACCCGGACATGCGTGGACTCCTCAAAAATATGAAACAGGGTAAAGCTGCGGGTTTCACAGAGGATGAACA[C/T]
GGAACCCTATGGAACGGAAATCGAGTATGCGTTCCAGATAACAGAGAACTTAAACAGCTGATACTTCAGGAAGCTCACGAAAGTCCTTATTCCATCCACC

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	3.90%	3.09%	24.80%	NA
All Indica	2759	71.20%	1.40%	1.41%	25.99%	NA
All Japonica	1512	65.30%	9.40%	4.23%	21.10%	NA
Aus	269	60.60%	0.00%	10.04%	29.37%	NA
Indica I	595	52.30%	2.00%	2.69%	43.03%	NA
Indica II	465	56.60%	1.50%	2.15%	39.78%	NA
Indica III	913	92.90%	0.20%	0.44%	6.46%	NA
Indica Intermediate	786	69.00%	2.30%	1.15%	27.61%	NA
Temperate Japonica	767	92.30%	0.40%	0.26%	7.04%	NA
Tropical Japonica	504	30.00%	24.40%	8.93%	36.71%	NA
Japonica Intermediate	241	53.10%	6.60%	7.05%	33.20%	NA
VI/Aromatic	96	49.00%	0.00%	10.42%	40.62%	NA
Intermediate	90	71.10%	2.20%	6.67%	20.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403922278	G -> DEL	LOC_Os04g07370.1	N	frameshift_variant	Average:37.63; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0403922278	G -> A	LOC_Os04g07370.1	synonymous_variant ; p.His1301His; LOW	synonymous_codon	Average:37.63; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403922278	6.42E-08	NA	mr1068	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	2.91E-09	2.91E-09	mr1068	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	1.62E-07	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	9.90E-06	2.56E-07	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	6.70E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	1.70E-08	NA	mr1090	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	2.68E-08	2.65E-11	mr1090	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	7.60E-06	NA	mr1094	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	1.22E-06	2.91E-08	mr1094	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	1.96E-07	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 43 entries

Previous1 2 3 4 5Next

Search for Variation information by Variation ID:

Detailed information for vg0403922278:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact