Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403922278:

Variant ID: vg0403922278 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3922278
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGGATGGAATAAGGACTTTCGTGAGCTTCCTGAAGTATCAGCTGTTTAAGTTCTCTGTTATCTGGAACGCATACTCGATTTCCGTTCCATAGGGTTCC[G/A]
TGTTCATCCTCTGTGAAACCCGCAGCTTTACCCTGTTTCATATTTTTGAGGAGTCCACGCATGTCCGGGTCGTTCCTCTGAGCCTCGCGGATTTGATCGA

Reverse complement sequence

TCGATCAAATCCGCGAGGCTCAGAGGAACGACCCGGACATGCGTGGACTCCTCAAAAATATGAAACAGGGTAAAGCTGCGGGTTTCACAGAGGATGAACA[C/T]
GGAACCCTATGGAACGGAAATCGAGTATGCGTTCCAGATAACAGAGAACTTAAACAGCTGATACTTCAGGAAGCTCACGAAAGTCCTTATTCCATCCACC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	68.20%	3.90%	3.09%	24.80%	NA
All Indica	2759	71.20%	1.40%	1.41%	25.99%	NA
All Japonica	1512	65.30%	9.40%	4.23%	21.10%	NA
Aus	269	60.60%	0.00%	10.04%	29.37%	NA
Indica I	595	52.30%	2.00%	2.69%	43.03%	NA
Indica II	465	56.60%	1.50%	2.15%	39.78%	NA
Indica III	913	92.90%	0.20%	0.44%	6.46%	NA
Indica Intermediate	786	69.00%	2.30%	1.15%	27.61%	NA
Temperate Japonica	767	92.30%	0.40%	0.26%	7.04%	NA
Tropical Japonica	504	30.00%	24.40%	8.93%	36.71%	NA
Japonica Intermediate	241	53.10%	6.60%	7.05%	33.20%	NA
VI/Aromatic	96	49.00%	0.00%	10.42%	40.62%	NA
Intermediate	90	71.10%	2.20%	6.67%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403922278	G -> DEL	LOC_Os04g07370.1	N	frameshift_variant	Average:37.63; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N
vg0403922278	G -> A	LOC_Os04g07370.1	synonymous_variant ; p.His1301His; LOW	synonymous_codon	Average:37.63; most accessible tissue: Minghui63 young leaf, score: 76.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403922278	6.42E-08	NA	mr1068	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	2.91E-09	2.91E-09	mr1068	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	1.62E-07	mr1070	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	9.90E-06	2.56E-07	mr1078	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	6.70E-06	mr1087	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	1.70E-08	NA	mr1090	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	2.68E-08	2.65E-11	mr1090	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	7.60E-06	NA	mr1094	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	1.22E-06	2.91E-08	mr1094	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	1.96E-07	mr1096	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	6.56E-06	2.31E-09	mr1121	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	6.10E-06	mr1128	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	1.92E-09	NA	mr1211	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	4.34E-08	mr1211	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	1.04E-07	1.99E-09	mr1211	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	6.71E-06	NA	mr1068_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	1.38E-08	3.24E-11	mr1068_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	1.78E-06	7.77E-09	mr1078_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	4.98E-07	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	1.36E-09	6.88E-14	mr1090_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	1.32E-06	mr1092_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	1.98E-06	NA	mr1094_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	9.96E-08	1.74E-09	mr1094_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	3.94E-06	NA	mr1096_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	3.89E-07	5.62E-10	mr1096_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	4.53E-07	5.09E-09	mr1110_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	9.83E-08	9.82E-08	mr1111_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	3.01E-07	5.51E-09	mr1112_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	5.24E-07	NA	mr1121_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	2.04E-07	8.96E-11	mr1121_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	9.46E-07	mr1128_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	4.74E-06	3.11E-07	mr1144_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	3.51E-07	mr1152_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	4.48E-06	mr1154_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	1.47E-07	mr1200_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	7.72E-06	mr1204_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	1.76E-06	mr1204_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	1.49E-10	NA	mr1211_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	1.31E-07	mr1211_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	4.83E-10	1.50E-13	mr1211_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	NA	7.98E-06	mr1545_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	3.81E-06	NA	mr1583_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403922278	4.14E-08	NA	mr1850_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251