\
| Variant ID: vg0403840443 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3840443 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 213. )
AAATGGGCTTATATGTTGCAAGGACTTAATGGAGAAGTCTATGGACGAGCGCTCAATGGCAAATACTTGAAGAAATATTACCCAAGTGTTTGGGTGAATG[C/A]
ATGATCGGCTGGATGTTGCCGATGCATGTTAGCCGATGTGTTTACATCGCCTTCAGATGGCCGATATTGTTATATCGCCCTTAGCTGTTTTCATACTGTA
TACAGTATGAAAACAGCTAAGGGCGATATAACAATATCGGCCATCTGAAGGCGATGTAAACACATCGGCTAACATGCATCGGCAACATCCAGCCGATCAT[G/T]
CATTCACCCAAACACTTGGGTAATATTTCTTCAAGTATTTGCCATTGAGCGCTCGTCCATAGACTTCTCCATTAAGTCCTTGCAACATATAAGCCCATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 76.30% | 19.70% | 0.99% | 2.98% | NA |
| All Indica | 2759 | 67.90% | 31.00% | 0.80% | 0.36% | NA |
| All Japonica | 1512 | 88.20% | 1.60% | 1.52% | 8.66% | NA |
| Aus | 269 | 85.50% | 14.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 81.90% | 15.90% | 1.08% | 1.08% | NA |
| Indica III | 913 | 36.80% | 61.60% | 1.20% | 0.44% | NA |
| Indica Intermediate | 786 | 71.80% | 27.50% | 0.64% | 0.13% | NA |
| Temperate Japonica | 767 | 98.70% | 0.00% | 0.26% | 1.04% | NA |
| Tropical Japonica | 504 | 72.00% | 3.60% | 3.17% | 21.23% | NA |
| Japonica Intermediate | 241 | 88.80% | 2.50% | 2.07% | 6.64% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 14.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403840443 | C -> DEL | N | N | silent_mutation | Average:33.448; most accessible tissue: Zhenshan97 young leaf, score: 45.281 | N | N | N | N |
| vg0403840443 | C -> A | LOC_Os04g07230.1 | downstream_gene_variant ; 3159.0bp to feature; MODIFIER | silent_mutation | Average:33.448; most accessible tissue: Zhenshan97 young leaf, score: 45.281 | N | N | N | N |
| vg0403840443 | C -> A | LOC_Os04g07240.1 | downstream_gene_variant ; 828.0bp to feature; MODIFIER | silent_mutation | Average:33.448; most accessible tissue: Zhenshan97 young leaf, score: 45.281 | N | N | N | N |
| vg0403840443 | C -> A | LOC_Os04g07230-LOC_Os04g07240 | intergenic_region ; MODIFIER | silent_mutation | Average:33.448; most accessible tissue: Zhenshan97 young leaf, score: 45.281 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403840443 | NA | 7.27E-06 | mr1037 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403840443 | NA | 1.37E-06 | mr1155 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403840443 | NA | 5.43E-09 | mr1213 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403840443 | NA | 1.63E-06 | mr1277 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403840443 | NA | 2.57E-07 | mr1798 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403840443 | NA | 2.58E-06 | mr1037_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403840443 | NA | 7.16E-08 | mr1155_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403840443 | 3.44E-07 | NA | mr1798_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403840443 | 2.16E-07 | 3.93E-14 | mr1798_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |