\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403840443:

Variant ID: vg0403840443 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3840443
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


AAATGGGCTTATATGTTGCAAGGACTTAATGGAGAAGTCTATGGACGAGCGCTCAATGGCAAATACTTGAAGAAATATTACCCAAGTGTTTGGGTGAATG[C/A]
ATGATCGGCTGGATGTTGCCGATGCATGTTAGCCGATGTGTTTACATCGCCTTCAGATGGCCGATATTGTTATATCGCCCTTAGCTGTTTTCATACTGTA

Reverse complement sequence

TACAGTATGAAAACAGCTAAGGGCGATATAACAATATCGGCCATCTGAAGGCGATGTAAACACATCGGCTAACATGCATCGGCAACATCCAGCCGATCAT[G/T]
CATTCACCCAAACACTTGGGTAATATTTCTTCAAGTATTTGCCATTGAGCGCTCGTCCATAGACTTCTCCATTAAGTCCTTGCAACATATAAGCCCATTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.30% 19.70% 0.99% 2.98% NA
All Indica  2759 67.90% 31.00% 0.80% 0.36% NA
All Japonica  1512 88.20% 1.60% 1.52% 8.66% NA
Aus  269 85.50% 14.50% 0.00% 0.00% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 81.90% 15.90% 1.08% 1.08% NA
Indica III  913 36.80% 61.60% 1.20% 0.44% NA
Indica Intermediate  786 71.80% 27.50% 0.64% 0.13% NA
Temperate Japonica  767 98.70% 0.00% 0.26% 1.04% NA
Tropical Japonica  504 72.00% 3.60% 3.17% 21.23% NA
Japonica Intermediate  241 88.80% 2.50% 2.07% 6.64% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 83.30% 14.40% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403840443 C -> DEL N N silent_mutation Average:33.448; most accessible tissue: Zhenshan97 young leaf, score: 45.281 N N N N
vg0403840443 C -> A LOC_Os04g07230.1 downstream_gene_variant ; 3159.0bp to feature; MODIFIER silent_mutation Average:33.448; most accessible tissue: Zhenshan97 young leaf, score: 45.281 N N N N
vg0403840443 C -> A LOC_Os04g07240.1 downstream_gene_variant ; 828.0bp to feature; MODIFIER silent_mutation Average:33.448; most accessible tissue: Zhenshan97 young leaf, score: 45.281 N N N N
vg0403840443 C -> A LOC_Os04g07230-LOC_Os04g07240 intergenic_region ; MODIFIER silent_mutation Average:33.448; most accessible tissue: Zhenshan97 young leaf, score: 45.281 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403840443 NA 7.27E-06 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443 NA 1.37E-06 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443 NA 5.43E-09 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443 NA 1.63E-06 mr1277 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443 NA 2.57E-07 mr1798 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443 NA 2.58E-06 mr1037_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443 NA 7.16E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443 3.44E-07 NA mr1798_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443 2.16E-07 3.93E-14 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251