Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403840443:

Variant ID: vg0403840443 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3840443
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, A: 0.01, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

AAATGGGCTTATATGTTGCAAGGACTTAATGGAGAAGTCTATGGACGAGCGCTCAATGGCAAATACTTGAAGAAATATTACCCAAGTGTTTGGGTGAATG[C/A]
ATGATCGGCTGGATGTTGCCGATGCATGTTAGCCGATGTGTTTACATCGCCTTCAGATGGCCGATATTGTTATATCGCCCTTAGCTGTTTTCATACTGTA

Reverse complement sequence

TACAGTATGAAAACAGCTAAGGGCGATATAACAATATCGGCCATCTGAAGGCGATGTAAACACATCGGCTAACATGCATCGGCAACATCCAGCCGATCAT[G/T]
CATTCACCCAAACACTTGGGTAATATTTCTTCAAGTATTTGCCATTGAGCGCTCGTCCATAGACTTCTCCATTAAGTCCTTGCAACATATAAGCCCATTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.30%	19.70%	0.99%	2.98%	NA
All Indica	2759	67.90%	31.00%	0.80%	0.36%	NA
All Japonica	1512	88.20%	1.60%	1.52%	8.66%	NA
Aus	269	85.50%	14.50%	0.00%	0.00%	NA
Indica I	595	99.30%	0.50%	0.17%	0.00%	NA
Indica II	465	81.90%	15.90%	1.08%	1.08%	NA
Indica III	913	36.80%	61.60%	1.20%	0.44%	NA
Indica Intermediate	786	71.80%	27.50%	0.64%	0.13%	NA
Temperate Japonica	767	98.70%	0.00%	0.26%	1.04%	NA
Tropical Japonica	504	72.00%	3.60%	3.17%	21.23%	NA
Japonica Intermediate	241	88.80%	2.50%	2.07%	6.64%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	83.30%	14.40%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403840443	C -> DEL	N	N	silent_mutation	Average:33.448; most accessible tissue: Zhenshan97 young leaf, score: 45.281	N	N	N	N
vg0403840443	C -> A	LOC_Os04g07230.1	downstream_gene_variant ; 3159.0bp to feature; MODIFIER	silent_mutation	Average:33.448; most accessible tissue: Zhenshan97 young leaf, score: 45.281	N	N	N	N
vg0403840443	C -> A	LOC_Os04g07240.1	downstream_gene_variant ; 828.0bp to feature; MODIFIER	silent_mutation	Average:33.448; most accessible tissue: Zhenshan97 young leaf, score: 45.281	N	N	N	N
vg0403840443	C -> A	LOC_Os04g07230-LOC_Os04g07240	intergenic_region ; MODIFIER	silent_mutation	Average:33.448; most accessible tissue: Zhenshan97 young leaf, score: 45.281	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403840443	NA	7.27E-06	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443	NA	1.37E-06	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443	NA	5.43E-09	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443	NA	1.63E-06	mr1277	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443	NA	2.57E-07	mr1798	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443	NA	2.58E-06	mr1037_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443	NA	7.16E-08	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443	3.44E-07	NA	mr1798_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403840443	2.16E-07	3.93E-14	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251