\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403709681:

Variant ID: vg0403709681 (JBrowse)Variation Type: INDEL
Chromosome: chr04Position: 3709681
Reference Allele: TAlternative Allele: C,TAC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCGAGGGGGGAGGTAGGGCAAGCAGGGGGGGCGGGGAGGCCAGTGGCGACCTCCTCACCGGGCAGAGACGCCAATAGTGCAGAGAGGACGAGCACCACGG[T/C,TAC]
GGGGTTGACCACCGCGGCATCAGGATCGCGCGCGAGGAATGGAGCGTAGATGGAGGCGGCGGCGGAGGGAGCGAACTGCTGGTGGAGGATGGAGTGGAAG

Reverse complement sequence

CTTCCACTCCATCCTCCACCAGCAGTTCGCTCCCTCCGCCGCCGCCTCCATCTACGCTCCATTCCTCGCGCGCGATCCTGATGCCGCGGTGGTCAACCCC[A/G,GTA]
CCGTGGTGCTCGTCCTCTCTGCACTATTGGCGTCTCTGCCCGGTGAGGAGGTCGCCACTGGCCTCCCCGCCCCCCCTGCTTGCCCTACCTCCCCCCTCGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.20% 29.70% 0.89% 1.76% TAC: 0.40%
All Indica  2759 51.10% 46.60% 1.38% 0.22% TAC: 0.69%
All Japonica  1512 88.80% 6.30% 0.20% 4.76% NA
Aus  269 97.40% 1.10% 0.00% 1.49% NA
Indica I  595 5.70% 92.40% 1.68% 0.17% NA
Indica II  465 53.50% 44.30% 2.15% 0.00% NA
Indica III  913 77.00% 20.20% 0.77% 0.22% TAC: 1.86%
Indica Intermediate  786 54.10% 43.90% 1.40% 0.38% TAC: 0.25%
Temperate Japonica  767 98.40% 0.30% 0.00% 1.30% NA
Tropical Japonica  504 80.00% 16.70% 0.60% 2.78% NA
Japonica Intermediate  241 76.30% 3.70% 0.00% 19.92% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 75.60% 22.20% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403709681 T -> C LOC_Os04g07060-LOC_Os04g07040 intergenic_region ; MODIFIER silent_mutation Average:56.592; most accessible tissue: Zhenshan97 young leaf, score: 83.412 N N N N
vg0403709681 T -> DEL N N silent_mutation Average:56.592; most accessible tissue: Zhenshan97 young leaf, score: 83.412 N N N N
vg0403709681 T -> TAC LOC_Os04g07060-LOC_Os04g07040 intergenic_region ; MODIFIER silent_mutation Average:56.592; most accessible tissue: Zhenshan97 young leaf, score: 83.412 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403709681 8.06E-06 8.06E-06 mr1147_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 NA 8.31E-06 mr1204_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 NA 4.32E-06 mr1252_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 1.50E-06 1.50E-06 mr1279_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 3.67E-09 3.67E-09 mr1313_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 8.54E-07 8.54E-07 mr1440_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 NA 7.92E-17 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 1.71E-08 1.71E-08 mr1473_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 5.14E-06 5.13E-06 mr1485_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 3.95E-06 3.95E-06 mr1537_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 NA 6.07E-06 mr1556_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 1.55E-08 1.55E-08 mr1630_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 3.40E-06 3.40E-06 mr1753_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 NA 7.04E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 NA 9.21E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 2.88E-06 1.84E-06 mr1976_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403709681 4.57E-06 4.57E-06 mr1985_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251