Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403589171:

Variant ID: vg0403589171 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3589171
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

AAGTAGTTAATTAAGTATAGTTCCATACCTTGTGCCTACTTGCTGCTGGTTTTGTAGTGAGATGGTCGATCTGATTTAGGTTGCTGATTAATTAGGAGGG[T/C]
TTCTAGATGCGAATTGACGGATCTGCCATATGATAGCAGAACGAAGCAACATCGTCAGTGCAATTCCCTCCCATCACCCCTGCAGTCTGCGGTGTAGATT

Reverse complement sequence

AATCTACACCGCAGACTGCAGGGGTGATGGGAGGGAATTGCACTGACGATGTTGCTTCGTTCTGCTATCATATGGCAGATCCGTCAATTCGCATCTAGAA[A/G]
CCCTCCTAATTAATCAGCAACCTAAATCAGATCGACCATCTCACTACAAAACCAGCAGCAAGTAGGCACAAGGTATGGAACTATACTTAATTAACTACTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.90%	37.50%	3.05%	6.58%	NA
All Indica	2759	56.90%	32.50%	3.55%	7.03%	NA
All Japonica	1512	56.40%	37.00%	1.46%	5.16%	NA
Aus	269	4.80%	82.90%	5.58%	6.69%	NA
Indica I	595	96.50%	2.90%	0.50%	0.17%	NA
Indica II	465	57.80%	30.10%	6.88%	5.16%	NA
Indica III	913	33.30%	50.70%	2.41%	13.58%	NA
Indica Intermediate	786	53.80%	35.20%	5.22%	5.73%	NA
Temperate Japonica	767	53.70%	45.00%	0.13%	1.17%	NA
Tropical Japonica	504	68.70%	24.00%	3.17%	4.17%	NA
Japonica Intermediate	241	39.40%	38.60%	2.07%	19.92%	NA
VI/Aromatic	96	10.40%	67.70%	5.21%	16.67%	NA
Intermediate	90	60.00%	30.00%	4.44%	5.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403589171	T -> C	LOC_Os04g06820.1	downstream_gene_variant ; 4057.0bp to feature; MODIFIER	silent_mutation	Average:58.785; most accessible tissue: Callus, score: 82.26	N	N	N	N
vg0403589171	T -> C	LOC_Os04g06800-LOC_Os04g06820	intergenic_region ; MODIFIER	silent_mutation	Average:58.785; most accessible tissue: Callus, score: 82.26	N	N	N	N
vg0403589171	T -> DEL	N	N	silent_mutation	Average:58.785; most accessible tissue: Callus, score: 82.26	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403589171	2.82E-07	2.82E-07	mr1175	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171	NA	2.28E-06	mr1220	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171	NA	5.34E-07	mr1352	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171	NA	2.16E-06	mr1580	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171	NA	8.99E-07	mr1583	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171	NA	3.79E-07	mr1125_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171	NA	1.31E-06	mr1511_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171	NA	4.17E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171	NA	8.76E-07	mr1583_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171	NA	2.34E-06	mr1729_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171	NA	2.59E-08	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171	NA	8.40E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171	NA	1.08E-08	mr1798_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171	NA	4.22E-08	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251