\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403589171:

Variant ID: vg0403589171 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3589171
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTAGTTAATTAAGTATAGTTCCATACCTTGTGCCTACTTGCTGCTGGTTTTGTAGTGAGATGGTCGATCTGATTTAGGTTGCTGATTAATTAGGAGGG[T/C]
TTCTAGATGCGAATTGACGGATCTGCCATATGATAGCAGAACGAAGCAACATCGTCAGTGCAATTCCCTCCCATCACCCCTGCAGTCTGCGGTGTAGATT

Reverse complement sequence

AATCTACACCGCAGACTGCAGGGGTGATGGGAGGGAATTGCACTGACGATGTTGCTTCGTTCTGCTATCATATGGCAGATCCGTCAATTCGCATCTAGAA[A/G]
CCCTCCTAATTAATCAGCAACCTAAATCAGATCGACCATCTCACTACAAAACCAGCAGCAAGTAGGCACAAGGTATGGAACTATACTTAATTAACTACTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 37.50% 3.05% 6.58% NA
All Indica  2759 56.90% 32.50% 3.55% 7.03% NA
All Japonica  1512 56.40% 37.00% 1.46% 5.16% NA
Aus  269 4.80% 82.90% 5.58% 6.69% NA
Indica I  595 96.50% 2.90% 0.50% 0.17% NA
Indica II  465 57.80% 30.10% 6.88% 5.16% NA
Indica III  913 33.30% 50.70% 2.41% 13.58% NA
Indica Intermediate  786 53.80% 35.20% 5.22% 5.73% NA
Temperate Japonica  767 53.70% 45.00% 0.13% 1.17% NA
Tropical Japonica  504 68.70% 24.00% 3.17% 4.17% NA
Japonica Intermediate  241 39.40% 38.60% 2.07% 19.92% NA
VI/Aromatic  96 10.40% 67.70% 5.21% 16.67% NA
Intermediate  90 60.00% 30.00% 4.44% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403589171 T -> C LOC_Os04g06820.1 downstream_gene_variant ; 4057.0bp to feature; MODIFIER silent_mutation Average:58.785; most accessible tissue: Callus, score: 82.26 N N N N
vg0403589171 T -> C LOC_Os04g06800-LOC_Os04g06820 intergenic_region ; MODIFIER silent_mutation Average:58.785; most accessible tissue: Callus, score: 82.26 N N N N
vg0403589171 T -> DEL N N silent_mutation Average:58.785; most accessible tissue: Callus, score: 82.26 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403589171 2.82E-07 2.82E-07 mr1175 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171 NA 2.28E-06 mr1220 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171 NA 5.34E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171 NA 2.16E-06 mr1580 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171 NA 8.99E-07 mr1583 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171 NA 3.79E-07 mr1125_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171 NA 1.31E-06 mr1511_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171 NA 4.17E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171 NA 8.76E-07 mr1583_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171 NA 2.34E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171 NA 2.59E-08 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171 NA 8.40E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171 NA 1.08E-08 mr1798_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403589171 NA 4.22E-08 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251