\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403586262:

Variant ID: vg0403586262 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3586262
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCATTTTGACATATGTGGTAATCCTTCAAGGTTGAAGTGTGCGAGGTGAACAACTGAATATAGCTCAAGGTTTATCCGTTCATCCGGGTTTAAGTATTAC[A/G]
CTTCACATAACTACTTTTATTTACGGCTAATTATTTTTTTCTGTGACATATAGCGCTTTCAATCATAGGGGTAGCAAGACACCAATGGTGACCTTGTCAA

Reverse complement sequence

TTGACAAGGTCACCATTGGTGTCTTGCTACCCCTATGATTGAAAGCGCTATATGTCACAGAAAAAAATAATTAGCCGTAAATAAAAGTAGTTATGTGAAG[T/C]
GTAATACTTAAACCCGGATGAACGGATAAACCTTGAGCTATATTCAGTTGTTCACCTCGCACACTTCAACCTTGAAGGATTACCACATATGTCAAAATGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.90% 12.50% 0.68% 2.86% NA
All Indica  2759 89.90% 5.40% 0.22% 4.49% NA
All Japonica  1512 69.50% 28.60% 1.72% 0.20% NA
Aus  269 94.80% 3.00% 0.00% 2.23% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 87.50% 8.20% 0.22% 4.09% NA
Indica III  913 86.70% 4.70% 0.11% 8.43% NA
Indica Intermediate  786 88.00% 7.90% 0.51% 3.56% NA
Temperate Japonica  767 56.20% 42.90% 0.91% 0.00% NA
Tropical Japonica  504 91.30% 7.30% 0.79% 0.60% NA
Japonica Intermediate  241 66.40% 27.40% 6.22% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 3.30% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403586262 A -> DEL N N silent_mutation Average:32.106; most accessible tissue: Callus, score: 76.818 N N N N
vg0403586262 A -> G LOC_Os04g06790.1 upstream_gene_variant ; 4707.0bp to feature; MODIFIER silent_mutation Average:32.106; most accessible tissue: Callus, score: 76.818 N N N N
vg0403586262 A -> G LOC_Os04g06800.1 upstream_gene_variant ; 3056.0bp to feature; MODIFIER silent_mutation Average:32.106; most accessible tissue: Callus, score: 76.818 N N N N
vg0403586262 A -> G LOC_Os04g06790.2 upstream_gene_variant ; 4628.0bp to feature; MODIFIER silent_mutation Average:32.106; most accessible tissue: Callus, score: 76.818 N N N N
vg0403586262 A -> G LOC_Os04g06790.3 upstream_gene_variant ; 4628.0bp to feature; MODIFIER silent_mutation Average:32.106; most accessible tissue: Callus, score: 76.818 N N N N
vg0403586262 A -> G LOC_Os04g06800-LOC_Os04g06820 intergenic_region ; MODIFIER silent_mutation Average:32.106; most accessible tissue: Callus, score: 76.818 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403586262 NA 1.22E-11 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0403586262 NA 7.03E-09 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403586262 NA 1.69E-07 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403586262 NA 4.65E-06 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403586262 NA 2.40E-08 mr1733_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403586262 NA 5.39E-10 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251