\
| Variant ID: vg0403586262 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3586262 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCATTTTGACATATGTGGTAATCCTTCAAGGTTGAAGTGTGCGAGGTGAACAACTGAATATAGCTCAAGGTTTATCCGTTCATCCGGGTTTAAGTATTAC[A/G]
CTTCACATAACTACTTTTATTTACGGCTAATTATTTTTTTCTGTGACATATAGCGCTTTCAATCATAGGGGTAGCAAGACACCAATGGTGACCTTGTCAA
TTGACAAGGTCACCATTGGTGTCTTGCTACCCCTATGATTGAAAGCGCTATATGTCACAGAAAAAAATAATTAGCCGTAAATAAAAGTAGTTATGTGAAG[T/C]
GTAATACTTAAACCCGGATGAACGGATAAACCTTGAGCTATATTCAGTTGTTCACCTCGCACACTTCAACCTTGAAGGATTACCACATATGTCAAAATGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.90% | 12.50% | 0.68% | 2.86% | NA |
| All Indica | 2759 | 89.90% | 5.40% | 0.22% | 4.49% | NA |
| All Japonica | 1512 | 69.50% | 28.60% | 1.72% | 0.20% | NA |
| Aus | 269 | 94.80% | 3.00% | 0.00% | 2.23% | NA |
| Indica I | 595 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 87.50% | 8.20% | 0.22% | 4.09% | NA |
| Indica III | 913 | 86.70% | 4.70% | 0.11% | 8.43% | NA |
| Indica Intermediate | 786 | 88.00% | 7.90% | 0.51% | 3.56% | NA |
| Temperate Japonica | 767 | 56.20% | 42.90% | 0.91% | 0.00% | NA |
| Tropical Japonica | 504 | 91.30% | 7.30% | 0.79% | 0.60% | NA |
| Japonica Intermediate | 241 | 66.40% | 27.40% | 6.22% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 3.30% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403586262 | A -> DEL | N | N | silent_mutation | Average:32.106; most accessible tissue: Callus, score: 76.818 | N | N | N | N |
| vg0403586262 | A -> G | LOC_Os04g06790.1 | upstream_gene_variant ; 4707.0bp to feature; MODIFIER | silent_mutation | Average:32.106; most accessible tissue: Callus, score: 76.818 | N | N | N | N |
| vg0403586262 | A -> G | LOC_Os04g06800.1 | upstream_gene_variant ; 3056.0bp to feature; MODIFIER | silent_mutation | Average:32.106; most accessible tissue: Callus, score: 76.818 | N | N | N | N |
| vg0403586262 | A -> G | LOC_Os04g06790.2 | upstream_gene_variant ; 4628.0bp to feature; MODIFIER | silent_mutation | Average:32.106; most accessible tissue: Callus, score: 76.818 | N | N | N | N |
| vg0403586262 | A -> G | LOC_Os04g06790.3 | upstream_gene_variant ; 4628.0bp to feature; MODIFIER | silent_mutation | Average:32.106; most accessible tissue: Callus, score: 76.818 | N | N | N | N |
| vg0403586262 | A -> G | LOC_Os04g06800-LOC_Os04g06820 | intergenic_region ; MODIFIER | silent_mutation | Average:32.106; most accessible tissue: Callus, score: 76.818 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403586262 | NA | 1.22E-11 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0403586262 | NA | 7.03E-09 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403586262 | NA | 1.69E-07 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403586262 | NA | 4.65E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403586262 | NA | 2.40E-08 | mr1733_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403586262 | NA | 5.39E-10 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |