\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403579142:

Variant ID: vg0403579142 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3579142
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.08, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AACAAAAAGAATTGTGTGAAAAGTATAGGAGAACTTGGGGTAACAAAACATATTTTACAAGATTTAGATCGCTTAATCGATATGCGGTGAAGAAAAATCA[T/A]
CATATCTAGAAAAATGTAGTATAGCAAATGCTGAACTCGTATTAAATTCGGATGACGATAATGAGTATACCACATTGATGTGTAATCAGTTAGACATCAA

Reverse complement sequence

TTGATGTCTAACTGATTACACATCAATGTGGTATACTCATTATCGTCATCCGAATTTAATACGAGTTCAGCATTTGCTATACTACATTTTTCTAGATATG[A/T]
TGATTTTTCTTCACCGCATATCGATTAAGCGATCTAAATCTTGTAAAATATGTTTTGTTACCCCAAGTTCTCCTATACTTTTCACACAATTCTTTTTGTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 11.10% 0.02% 0.00% NA
All Indica  2759 91.60% 8.30% 0.04% 0.00% NA
All Japonica  1512 82.70% 17.30% 0.00% 0.00% NA
Aus  269 88.80% 11.20% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 90.80% 9.20% 0.00% 0.00% NA
Indica III  913 86.10% 13.90% 0.00% 0.00% NA
Indica Intermediate  786 92.20% 7.60% 0.13% 0.00% NA
Temperate Japonica  767 78.40% 21.60% 0.00% 0.00% NA
Tropical Japonica  504 92.10% 7.90% 0.00% 0.00% NA
Japonica Intermediate  241 77.20% 22.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403579142 T -> A LOC_Os04g06790.1 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg0403579142 T -> A LOC_Os04g06790.1 5_prime_UTR_variant ; 287.0bp to feature; MODIFIER silent_mutation Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg0403579142 T -> A LOC_Os04g06800.1 downstream_gene_variant ; 2942.0bp to feature; MODIFIER silent_mutation Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg0403579142 T -> A LOC_Os04g06790.2 intron_variant ; MODIFIER silent_mutation Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N
vg0403579142 T -> A LOC_Os04g06790.3 intron_variant ; MODIFIER silent_mutation Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403579142 4.10E-07 4.10E-07 mr1360_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403579142 4.29E-06 4.29E-06 mr1371_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403579142 6.35E-07 6.35E-07 mr1445_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403579142 2.97E-06 2.97E-06 mr1452_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251