\
| Variant ID: vg0403579142 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3579142 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.08, others allele: 0.00, population size: 227. )
AACAAAAAGAATTGTGTGAAAAGTATAGGAGAACTTGGGGTAACAAAACATATTTTACAAGATTTAGATCGCTTAATCGATATGCGGTGAAGAAAAATCA[T/A]
CATATCTAGAAAAATGTAGTATAGCAAATGCTGAACTCGTATTAAATTCGGATGACGATAATGAGTATACCACATTGATGTGTAATCAGTTAGACATCAA
TTGATGTCTAACTGATTACACATCAATGTGGTATACTCATTATCGTCATCCGAATTTAATACGAGTTCAGCATTTGCTATACTACATTTTTCTAGATATG[A/T]
TGATTTTTCTTCACCGCATATCGATTAAGCGATCTAAATCTTGTAAAATATGTTTTGTTACCCCAAGTTCTCCTATACTTTTCACACAATTCTTTTTGTT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.90% | 11.10% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 91.60% | 8.30% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 82.70% | 17.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 88.80% | 11.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 86.10% | 13.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.20% | 7.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 78.40% | 21.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 77.20% | 22.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403579142 | T -> A | LOC_Os04g06790.1 | 5_prime_UTR_premature_start_codon_gain_variant ; LOW | silent_mutation | Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| vg0403579142 | T -> A | LOC_Os04g06790.1 | 5_prime_UTR_variant ; 287.0bp to feature; MODIFIER | silent_mutation | Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| vg0403579142 | T -> A | LOC_Os04g06800.1 | downstream_gene_variant ; 2942.0bp to feature; MODIFIER | silent_mutation | Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| vg0403579142 | T -> A | LOC_Os04g06790.2 | intron_variant ; MODIFIER | silent_mutation | Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| vg0403579142 | T -> A | LOC_Os04g06790.3 | intron_variant ; MODIFIER | silent_mutation | Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403579142 | 4.10E-07 | 4.10E-07 | mr1360_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403579142 | 4.29E-06 | 4.29E-06 | mr1371_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403579142 | 6.35E-07 | 6.35E-07 | mr1445_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403579142 | 2.97E-06 | 2.97E-06 | mr1452_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |