Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0403579142:

Variant ID: vg0403579142 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3579142
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.08, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

AACAAAAAGAATTGTGTGAAAAGTATAGGAGAACTTGGGGTAACAAAACATATTTTACAAGATTTAGATCGCTTAATCGATATGCGGTGAAGAAAAATCA[T/A]
CATATCTAGAAAAATGTAGTATAGCAAATGCTGAACTCGTATTAAATTCGGATGACGATAATGAGTATACCACATTGATGTGTAATCAGTTAGACATCAA

Reverse complement sequence

TTGATGTCTAACTGATTACACATCAATGTGGTATACTCATTATCGTCATCCGAATTTAATACGAGTTCAGCATTTGCTATACTACATTTTTCTAGATATG[A/T]
TGATTTTTCTTCACCGCATATCGATTAAGCGATCTAAATCTTGTAAAATATGTTTTGTTACCCCAAGTTCTCCTATACTTTTCACACAATTCTTTTTGTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.90%	11.10%	0.02%	0.00%	NA
All Indica	2759	91.60%	8.30%	0.04%	0.00%	NA
All Japonica	1512	82.70%	17.30%	0.00%	0.00%	NA
Aus	269	88.80%	11.20%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	90.80%	9.20%	0.00%	0.00%	NA
Indica III	913	86.10%	13.90%	0.00%	0.00%	NA
Indica Intermediate	786	92.20%	7.60%	0.13%	0.00%	NA
Temperate Japonica	767	78.40%	21.60%	0.00%	0.00%	NA
Tropical Japonica	504	92.10%	7.90%	0.00%	0.00%	NA
Japonica Intermediate	241	77.20%	22.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	2.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403579142	T -> A	LOC_Os04g06790.1	5_prime_UTR_premature_start_codon_gain_variant ; LOW	silent_mutation	Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0403579142	T -> A	LOC_Os04g06790.1	5_prime_UTR_variant ; 287.0bp to feature; MODIFIER	silent_mutation	Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0403579142	T -> A	LOC_Os04g06800.1	downstream_gene_variant ; 2942.0bp to feature; MODIFIER	silent_mutation	Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0403579142	T -> A	LOC_Os04g06790.2	intron_variant ; MODIFIER	silent_mutation	Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N
vg0403579142	T -> A	LOC_Os04g06790.3	intron_variant ; MODIFIER	silent_mutation	Average:52.755; most accessible tissue: Zhenshan97 young leaf, score: 71.065	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403579142	4.10E-07	4.10E-07	mr1360_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403579142	4.29E-06	4.29E-06	mr1371_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403579142	6.35E-07	6.35E-07	mr1445_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403579142	2.97E-06	2.97E-06	mr1452_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251