Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403573729:

Variant ID: vg0403573729 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3573729
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.02, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

AAATATAGTTGTTAATATTTTTTAACTTGAACACAATAATACTCACTAAGCAAACGCGAAGTAGCAGCGGTAGTCCAAATCAAGGTCGACTAGAGCATCT[C/A]
GATCCCATTACAGCCGAAGTCCCATGCGCTCGTGTTCATTCACGTTGGGACTTGCCATGTAAATTCTGCTTGTGTTATCGATTTGGTGATCATATCGGCA

Reverse complement sequence

TGCCGATATGATCACCAAATCGATAACACAAGCAGAATTTACATGGCAAGTCCCAACGTGAATGAACACGAGCGCATGGGACTTCGGCTGTAATGGGATC[G/T]
AGATGCTCTAGTCGACCTTGATTTGGACTACCGCTGCTACTTCGCGTTTGCTTAGTGAGTATTATTGTGTTCAAGTTAAAAAATATTAACAACTATATTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.70%	25.20%	0.08%	0.00%	NA
All Indica	2759	93.80%	6.10%	0.11%	0.00%	NA
All Japonica	1512	34.30%	65.60%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	86.90%	12.70%	0.43%	0.00%	NA
Indica III	913	97.00%	2.80%	0.11%	0.00%	NA
Indica Intermediate	786	90.30%	9.70%	0.00%	0.00%	NA
Temperate Japonica	767	30.00%	69.90%	0.13%	0.00%	NA
Tropical Japonica	504	31.90%	68.10%	0.00%	0.00%	NA
Japonica Intermediate	241	53.10%	46.90%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	72.20%	27.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403573729	C -> A	LOC_Os04g06790.1	downstream_gene_variant ; 1571.0bp to feature; MODIFIER	silent_mutation	Average:55.589; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0403573729	C -> A	LOC_Os04g06790.2	downstream_gene_variant ; 1571.0bp to feature; MODIFIER	silent_mutation	Average:55.589; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0403573729	C -> A	LOC_Os04g06790.3	downstream_gene_variant ; 1571.0bp to feature; MODIFIER	silent_mutation	Average:55.589; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N
vg0403573729	C -> A	LOC_Os04g06780-LOC_Os04g06790	intergenic_region ; MODIFIER	silent_mutation	Average:55.589; most accessible tissue: Zhenshan97 young leaf, score: 73.147	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403573729	NA	1.06E-13	mr1035	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403573729	NA	1.73E-06	mr1510	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403573729	NA	3.09E-12	mr1626	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403573729	NA	1.49E-15	mr1035_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403573729	NA	6.54E-06	mr1528_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403573729	NA	7.28E-07	mr1600_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403573729	1.97E-06	1.97E-06	mr1756_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251