\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403566373:

Variant ID: vg0403566373 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3566373
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.70, G: 0.31, others allele: 0.00, population size: 195. )

Flanking Sequence (100 bp) in Reference Genome:


ACCGCCCCATTGCCGTCCTCACCACCAGCGTTGCCACAAGGCTGAGGCGGACCTGCCCAGAAGACATGGCGGAGTGTAGGATCGTGATGTTGACTAGAGG[G/A]
GGGGTGAATAGGCGATTTAAAACTAAATGACACCTAATCAAAACTAACCTAAGTTGGTAGGTTTGGTGAGGGTCAACTCTAACTAAGCAACTAAGTTATG

Reverse complement sequence

CATAACTTAGTTGCTTAGTTAGAGTTGACCCTCACCAAACCTACCAACTTAGGTTAGTTTTGATTAGGTGTCATTTAGTTTTAAATCGCCTATTCACCCC[C/T]
CCTCTAGTCAACATCACGATCCTACACTCCGCCATGTCTTCTGGGCAGGTCCGCCTCAGCCTTGTGGCAACGCTGGTGGTGAGGACGGCAATGGGGCGGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.40% 34.10% 1.52% 0.00% NA
All Indica  2759 88.60% 9.50% 1.92% 0.00% NA
All Japonica  1512 14.00% 86.00% 0.00% 0.00% NA
Aus  269 90.00% 3.30% 6.69% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 78.70% 16.30% 4.95% 0.00% NA
Indica III  913 89.60% 8.90% 1.53% 0.00% NA
Indica Intermediate  786 85.50% 12.50% 2.04% 0.00% NA
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 25.00% 75.00% 0.00% 0.00% NA
Japonica Intermediate  241 29.50% 70.50% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 62.20% 36.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403566373 G -> A LOC_Os04g06770.1 upstream_gene_variant ; 3456.0bp to feature; MODIFIER silent_mutation Average:52.476; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg0403566373 G -> A LOC_Os04g06780.1 upstream_gene_variant ; 628.0bp to feature; MODIFIER silent_mutation Average:52.476; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg0403566373 G -> A LOC_Os04g06770.2 upstream_gene_variant ; 3580.0bp to feature; MODIFIER silent_mutation Average:52.476; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N
vg0403566373 G -> A LOC_Os04g06780-LOC_Os04g06790 intergenic_region ; MODIFIER silent_mutation Average:52.476; most accessible tissue: Zhenshan97 young leaf, score: 73.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403566373 NA 3.43E-13 mr1035_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566373 NA 7.02E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566373 4.19E-06 NA mr1786_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566373 NA 5.98E-06 mr1786_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566373 NA 2.38E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403566373 NA 2.87E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251