Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403552516:

Variant ID: vg0403552516 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3552516
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:

TTCAGTGCCTTAAGGACCAAAATCACTCTGCTATACCTATGATTTGCACACCTGCTGGTGGCTGGGTAGAGATCGGACTTTGGTATGTGTATTTACCATG[T/C]
ATCATTTTTCACCACTTAATTTTCCCATGACCATTTTTTGCTGTGGTCTTTATTAATAAGTTGAATTACTATACTTATTTATACTATCACATTAACTAAA

Reverse complement sequence

TTTAGTTAATGTGATAGTATAAATAAGTATAGTAATTCAACTTATTAATAAAGACCACAGCAAAAAATGGTCATGGGAAAATTAAGTGGTGAAAAATGAT[A/G]
CATGGTAAATACACATACCAAAGTCCGATCTCTACCCAGCCACCAGCAGGTGTGCAAATCATAGGTATAGCAGAGTGATTTTGGTCCTTAAGGCACTGAA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	61.60%	38.10%	0.28%	0.06%	NA
All Indica	2759	40.70%	58.80%	0.36%	0.11%	NA
All Japonica	1512	90.60%	9.30%	0.07%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	12.90%	86.20%	0.50%	0.34%	NA
Indica II	465	55.10%	44.90%	0.00%	0.00%	NA
Indica III	913	48.70%	51.30%	0.00%	0.00%	NA
Indica Intermediate	786	43.90%	55.10%	0.89%	0.13%	NA
Temperate Japonica	767	94.00%	5.90%	0.13%	0.00%	NA
Tropical Japonica	504	91.90%	8.10%	0.00%	0.00%	NA
Japonica Intermediate	241	77.20%	22.80%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	3.10%	1.04%	0.00%	NA
Intermediate	90	64.40%	34.40%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403552516	T -> C	LOC_Os04g06734.1	downstream_gene_variant ; 4554.0bp to feature; MODIFIER	silent_mutation	Average:43.514; most accessible tissue: Callus, score: 72.477	N	N	N	N
vg0403552516	T -> C	LOC_Os04g06770.1	downstream_gene_variant ; 2704.0bp to feature; MODIFIER	silent_mutation	Average:43.514; most accessible tissue: Callus, score: 72.477	N	N	N	N
vg0403552516	T -> C	LOC_Os04g06770.2	downstream_gene_variant ; 2704.0bp to feature; MODIFIER	silent_mutation	Average:43.514; most accessible tissue: Callus, score: 72.477	N	N	N	N
vg0403552516	T -> C	LOC_Os04g06734-LOC_Os04g06770	intergenic_region ; MODIFIER	silent_mutation	Average:43.514; most accessible tissue: Callus, score: 72.477	N	N	N	N
vg0403552516	T -> DEL	N	N	silent_mutation	Average:43.514; most accessible tissue: Callus, score: 72.477	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403552516	NA	9.09E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516	NA	2.21E-06	mr1417_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516	4.96E-06	4.96E-06	mr1417_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516	NA	3.07E-06	mr1759_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516	NA	7.10E-06	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516	NA	3.89E-06	mr1977_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516	NA	1.08E-06	mr1977_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516	4.47E-06	4.46E-06	mr1979_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251