\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403552516:

Variant ID: vg0403552516 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3552516
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAGTGCCTTAAGGACCAAAATCACTCTGCTATACCTATGATTTGCACACCTGCTGGTGGCTGGGTAGAGATCGGACTTTGGTATGTGTATTTACCATG[T/C]
ATCATTTTTCACCACTTAATTTTCCCATGACCATTTTTTGCTGTGGTCTTTATTAATAAGTTGAATTACTATACTTATTTATACTATCACATTAACTAAA

Reverse complement sequence

TTTAGTTAATGTGATAGTATAAATAAGTATAGTAATTCAACTTATTAATAAAGACCACAGCAAAAAATGGTCATGGGAAAATTAAGTGGTGAAAAATGAT[A/G]
CATGGTAAATACACATACCAAAGTCCGATCTCTACCCAGCCACCAGCAGGTGTGCAAATCATAGGTATAGCAGAGTGATTTTGGTCCTTAAGGCACTGAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 38.10% 0.28% 0.06% NA
All Indica  2759 40.70% 58.80% 0.36% 0.11% NA
All Japonica  1512 90.60% 9.30% 0.07% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 12.90% 86.20% 0.50% 0.34% NA
Indica II  465 55.10% 44.90% 0.00% 0.00% NA
Indica III  913 48.70% 51.30% 0.00% 0.00% NA
Indica Intermediate  786 43.90% 55.10% 0.89% 0.13% NA
Temperate Japonica  767 94.00% 5.90% 0.13% 0.00% NA
Tropical Japonica  504 91.90% 8.10% 0.00% 0.00% NA
Japonica Intermediate  241 77.20% 22.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 3.10% 1.04% 0.00% NA
Intermediate  90 64.40% 34.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403552516 T -> C LOC_Os04g06734.1 downstream_gene_variant ; 4554.0bp to feature; MODIFIER silent_mutation Average:43.514; most accessible tissue: Callus, score: 72.477 N N N N
vg0403552516 T -> C LOC_Os04g06770.1 downstream_gene_variant ; 2704.0bp to feature; MODIFIER silent_mutation Average:43.514; most accessible tissue: Callus, score: 72.477 N N N N
vg0403552516 T -> C LOC_Os04g06770.2 downstream_gene_variant ; 2704.0bp to feature; MODIFIER silent_mutation Average:43.514; most accessible tissue: Callus, score: 72.477 N N N N
vg0403552516 T -> C LOC_Os04g06734-LOC_Os04g06770 intergenic_region ; MODIFIER silent_mutation Average:43.514; most accessible tissue: Callus, score: 72.477 N N N N
vg0403552516 T -> DEL N N silent_mutation Average:43.514; most accessible tissue: Callus, score: 72.477 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403552516 NA 9.09E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516 NA 2.21E-06 mr1417_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516 4.96E-06 4.96E-06 mr1417_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516 NA 3.07E-06 mr1759_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516 NA 7.10E-06 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516 NA 3.89E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516 NA 1.08E-06 mr1977_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403552516 4.47E-06 4.46E-06 mr1979_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251