| Variant ID: vg0403528964 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3528964 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGTGCCTGTCAACTTTACAAAGATTCCGACATCCCACAAATCTGTCCAATGAGCTGACTCCTTTAACGATGACAAATTAAGGATAATGATGATTTGGCAA[C/A]
AAGTGTGCCACTGATATGCTAATGATATCCACACATTAATGTCCCTGTTGCATTTCTTTAGAGTCGAACTAATTAAACGCCGAAAGTTATTCCATACTTT
AAAGTATGGAATAACTTTCGGCGTTTAATTAGTTCGACTCTAAAGAAATGCAACAGGGACATTAATGTGTGGATATCATTAGCATATCAGTGGCACACTT[G/T]
TTGCCAAATCATCATTATCCTTAATTTGTCATCGTTAAAGGAGTCAGCTCATTGGACAGATTTGTGGGATGTCGGAATCTTTGTAAAGTTGACAGGCACT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.00% | 4.10% | 3.62% | 32.25% | NA |
| All Indica | 2759 | 43.80% | 1.50% | 5.47% | 49.26% | NA |
| All Japonica | 1512 | 81.30% | 10.00% | 0.53% | 8.13% | NA |
| Aus | 269 | 98.10% | 0.00% | 1.12% | 0.74% | NA |
| Indica I | 595 | 31.80% | 0.00% | 4.20% | 64.03% | NA |
| Indica II | 465 | 57.60% | 1.70% | 3.01% | 37.63% | NA |
| Indica III | 913 | 38.80% | 2.70% | 5.91% | 52.57% | NA |
| Indica Intermediate | 786 | 50.50% | 1.00% | 7.38% | 41.09% | NA |
| Temperate Japonica | 767 | 78.60% | 18.10% | 0.13% | 3.13% | NA |
| Tropical Japonica | 504 | 88.10% | 0.60% | 0.60% | 10.71% | NA |
| Japonica Intermediate | 241 | 75.90% | 3.70% | 1.66% | 18.67% | NA |
| VI/Aromatic | 96 | 76.00% | 1.00% | 4.17% | 18.75% | NA |
| Intermediate | 90 | 68.90% | 1.10% | 5.56% | 24.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403528964 | C -> DEL | N | N | silent_mutation | Average:44.538; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0403528964 | C -> A | LOC_Os04g06700.1 | downstream_gene_variant ; 950.0bp to feature; MODIFIER | silent_mutation | Average:44.538; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0403528964 | C -> A | LOC_Os04g06690-LOC_Os04g06700 | intergenic_region ; MODIFIER | silent_mutation | Average:44.538; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403528964 | 2.32E-15 | 1.44E-31 | Awn_length | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0403528964 | NA | 4.55E-14 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0403528964 | 3.74E-06 | 3.27E-12 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0403528964 | NA | 6.79E-12 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0403528964 | NA | 1.14E-08 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403528964 | NA | 2.60E-09 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403528964 | NA | 2.66E-08 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403528964 | NA | 7.54E-06 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403528964 | NA | 2.72E-08 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/