\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403515281:

Variant ID: vg0403515281 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3515281
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


CTGAGATCAGAAGCTATTCATATGAGCTACACTTGGTCTATATCACCCAGAAGATCTATTACTCGGGAGCATGTTACATGCGTCATCTTTTAAAGGGTGT[C/T]
GAAGGCATATGTTTTGGCCTAGGCCTAATATGTCTGCAGCCCATATTTTCAGGTGTGGCCTGTCACGTTCTTTTAGGGACTTAGGCACTTTTTGCTTAGG

Reverse complement sequence

CCTAAGCAAAAAGTGCCTAAGTCCCTAAAAGAACGTGACAGGCCACACCTGAAAATATGGGCTGCAGACATATTAGGCCTAGGCCAAAACATATGCCTTC[G/A]
ACACCCTTTAAAAGATGACGCATGTAACATGCTCCCGAGTAATAGATCTTCTGGGTGATATAGACCAAGTGTAGCTCATATGAATAGCTTCTGATCTCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 36.90% 13.70% 24.55% 24.80% NA
All Indica  2759 30.00% 10.60% 24.79% 34.58% NA
All Japonica  1512 57.70% 2.80% 26.39% 13.10% NA
Aus  269 3.30% 80.70% 15.24% 0.74% NA
Indica I  595 11.90% 5.40% 11.93% 70.76% NA
Indica II  465 19.10% 5.60% 38.28% 36.99% NA
Indica III  913 49.80% 13.70% 20.81% 15.66% NA
Indica Intermediate  786 27.20% 13.90% 31.17% 27.74% NA
Temperate Japonica  767 84.20% 1.80% 9.13% 4.82% NA
Tropical Japonica  504 27.40% 0.60% 45.04% 26.98% NA
Japonica Intermediate  241 36.50% 10.80% 42.32% 10.37% NA
VI/Aromatic  96 8.30% 84.40% 6.25% 1.04% NA
Intermediate  90 31.10% 16.70% 33.33% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403515281 C -> DEL N N silent_mutation Average:8.068; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0403515281 C -> T LOC_Os04g06690.1 upstream_gene_variant ; 2933.0bp to feature; MODIFIER silent_mutation Average:8.068; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0403515281 C -> T LOC_Os04g06670.1 downstream_gene_variant ; 1867.0bp to feature; MODIFIER silent_mutation Average:8.068; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N
vg0403515281 C -> T LOC_Os04g06670-LOC_Os04g06690 intergenic_region ; MODIFIER silent_mutation Average:8.068; most accessible tissue: Zhenshan97 panicle, score: 16.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403515281 2.69E-06 NA mr1026 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 NA 5.26E-07 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 NA 4.61E-06 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 2.75E-06 NA mr1161 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 NA 2.69E-07 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 NA 6.03E-07 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 NA 8.65E-08 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 NA 1.51E-06 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 NA 1.54E-07 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 NA 1.00E-08 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 NA 6.23E-06 mr1402_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 NA 5.37E-07 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 1.97E-06 8.91E-13 mr1613_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 NA 3.88E-08 mr1619_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 NA 1.38E-09 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281 NA 6.97E-10 mr1962_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251