Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0403515281:

Variant ID: vg0403515281 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3515281
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.01, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

CTGAGATCAGAAGCTATTCATATGAGCTACACTTGGTCTATATCACCCAGAAGATCTATTACTCGGGAGCATGTTACATGCGTCATCTTTTAAAGGGTGT[C/T]
GAAGGCATATGTTTTGGCCTAGGCCTAATATGTCTGCAGCCCATATTTTCAGGTGTGGCCTGTCACGTTCTTTTAGGGACTTAGGCACTTTTTGCTTAGG

Reverse complement sequence

CCTAAGCAAAAAGTGCCTAAGTCCCTAAAAGAACGTGACAGGCCACACCTGAAAATATGGGCTGCAGACATATTAGGCCTAGGCCAAAACATATGCCTTC[G/A]
ACACCCTTTAAAAGATGACGCATGTAACATGCTCCCGAGTAATAGATCTTCTGGGTGATATAGACCAAGTGTAGCTCATATGAATAGCTTCTGATCTCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	36.90%	13.70%	24.55%	24.80%	NA
All Indica	2759	30.00%	10.60%	24.79%	34.58%	NA
All Japonica	1512	57.70%	2.80%	26.39%	13.10%	NA
Aus	269	3.30%	80.70%	15.24%	0.74%	NA
Indica I	595	11.90%	5.40%	11.93%	70.76%	NA
Indica II	465	19.10%	5.60%	38.28%	36.99%	NA
Indica III	913	49.80%	13.70%	20.81%	15.66%	NA
Indica Intermediate	786	27.20%	13.90%	31.17%	27.74%	NA
Temperate Japonica	767	84.20%	1.80%	9.13%	4.82%	NA
Tropical Japonica	504	27.40%	0.60%	45.04%	26.98%	NA
Japonica Intermediate	241	36.50%	10.80%	42.32%	10.37%	NA
VI/Aromatic	96	8.30%	84.40%	6.25%	1.04%	NA
Intermediate	90	31.10%	16.70%	33.33%	18.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403515281	C -> DEL	N	N	silent_mutation	Average:8.068; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0403515281	C -> T	LOC_Os04g06690.1	upstream_gene_variant ; 2933.0bp to feature; MODIFIER	silent_mutation	Average:8.068; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0403515281	C -> T	LOC_Os04g06670.1	downstream_gene_variant ; 1867.0bp to feature; MODIFIER	silent_mutation	Average:8.068; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N
vg0403515281	C -> T	LOC_Os04g06670-LOC_Os04g06690	intergenic_region ; MODIFIER	silent_mutation	Average:8.068; most accessible tissue: Zhenshan97 panicle, score: 16.188	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403515281	2.69E-06	NA	mr1026	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	NA	5.26E-07	mr1100	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	NA	4.61E-06	mr1140	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	2.75E-06	NA	mr1161	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	NA	2.69E-07	mr1613	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	NA	6.03E-07	mr1913	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	NA	8.65E-08	mr1071_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	NA	1.51E-06	mr1080_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	NA	1.54E-07	mr1100_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	NA	1.00E-08	mr1203_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	NA	6.23E-06	mr1402_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	NA	5.37E-07	mr1522_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	1.97E-06	8.91E-13	mr1613_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	NA	3.88E-08	mr1619_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	NA	1.38E-09	mr1913_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403515281	NA	6.97E-10	mr1962_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251