\
| Variant ID: vg0403478520 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3478520 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTCGTGCCATTCAATGCTTTCAATCCTCCTCCACCGGTATGTAATCAAACATTTCAACCTTTCACAAAATATAGTTTTGTCTTTTTGTTGAATCAATTAA[C/T]
AATGAAGGATATTACACCCAGGAATTTGCTTTGATGAAGTCGGATCCCCCAGTCGTTCAACGCCGATCACCCCACCACCAAACCGGTTGAGGGAGCGGGG
CCCCGCTCCCTCAACCGGTTTGGTGGTGGGGTGATCGGCGTTGAACGACTGGGGGATCCGACTTCATCAAAGCAAATTCCTGGGTGTAATATCCTTCATT[G/A]
TTAATTGATTCAACAAAAAGACAAAACTATATTTTGTGAAAGGTTGAAATGTTTGATTACATACCGGTGGAGGAGGATTGAAAGCATTGAATGGCACGAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 61.30% | 4.60% | 2.05% | 32.01% | NA |
| All Indica | 2759 | 49.50% | 0.30% | 1.96% | 48.31% | NA |
| All Japonica | 1512 | 76.30% | 13.80% | 2.45% | 7.54% | NA |
| Aus | 269 | 96.70% | 0.00% | 0.37% | 2.97% | NA |
| Indica I | 595 | 52.30% | 0.20% | 2.69% | 44.87% | NA |
| Indica II | 465 | 56.30% | 0.20% | 1.51% | 41.94% | NA |
| Indica III | 913 | 40.90% | 0.10% | 1.53% | 57.50% | NA |
| Indica Intermediate | 786 | 53.30% | 0.50% | 2.16% | 44.02% | NA |
| Temperate Japonica | 767 | 94.50% | 2.20% | 0.65% | 2.61% | NA |
| Tropical Japonica | 504 | 55.80% | 29.40% | 3.77% | 11.11% | NA |
| Japonica Intermediate | 241 | 61.00% | 17.80% | 5.39% | 15.77% | NA |
| VI/Aromatic | 96 | 65.60% | 0.00% | 1.04% | 33.33% | NA |
| Intermediate | 90 | 64.40% | 2.20% | 4.44% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403478520 | C -> DEL | N | N | silent_mutation | Average:29.052; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0403478520 | C -> T | LOC_Os04g06610.1 | downstream_gene_variant ; 2265.0bp to feature; MODIFIER | silent_mutation | Average:29.052; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| vg0403478520 | C -> T | LOC_Os04g06600.1 | intron_variant ; MODIFIER | silent_mutation | Average:29.052; most accessible tissue: Minghui63 panicle, score: 46.754 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403478520 | 8.32E-06 | NA | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403478520 | NA | 9.30E-07 | mr1155 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403478520 | NA | 2.67E-06 | mr1213 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403478520 | NA | 7.07E-17 | mr1301 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403478520 | NA | 9.84E-14 | mr1410 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403478520 | 3.19E-07 | NA | mr1104_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403478520 | 4.78E-06 | NA | mr1107_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403478520 | NA | 4.91E-06 | mr1155_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403478520 | NA | 2.65E-18 | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403478520 | NA | 1.11E-13 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403478520 | 3.43E-08 | NA | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |