\
| Variant ID: vg0403407500 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3407500 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 236. )
ACGATACTATTTCTTGCGCTTATTCTCGTGATTCTCCTGTGGCCATCTCCAGTTATGTATCAATAAGACAGTTATACTTTTCCCCTAAACAAAAGGACAA[A/T]
CCATGTTCATCTATGAGGAGATTGATCATTCTCTTGATTGGTGAACAACGGACAATATTATTATCAATTCTTTACAATTACAGGCTTGATAAGCTGATCA
TGATCAGCTTATCAAGCCTGTAATTGTAAAGAATTGATAATAATATTGTCCGTTGTTCACCAATCAAGAGAATGATCAATCTCCTCATAGATGAACATGG[T/A]
TTGTCCTTTTGTTTAGGGGAAAAGTATAACTGTCTTATTGATACATAACTGGAGATGGCCACAGGAGAATCACGAGAATAAGCGCAAGAAATAGTATCGT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.60% | 10.20% | 4.19% | 33.96% | NA |
| All Indica | 2759 | 26.20% | 10.20% | 6.71% | 56.87% | NA |
| All Japonica | 1512 | 89.20% | 9.90% | 0.46% | 0.46% | NA |
| Aus | 269 | 97.80% | 1.50% | 0.37% | 0.37% | NA |
| Indica I | 595 | 10.80% | 6.10% | 3.70% | 79.50% | NA |
| Indica II | 465 | 38.10% | 3.70% | 3.87% | 54.41% | NA |
| Indica III | 913 | 26.40% | 14.80% | 11.61% | 47.21% | NA |
| Indica Intermediate | 786 | 30.70% | 12.00% | 4.96% | 52.42% | NA |
| Temperate Japonica | 767 | 93.90% | 5.50% | 0.39% | 0.26% | NA |
| Tropical Japonica | 504 | 88.30% | 10.70% | 0.40% | 0.60% | NA |
| Japonica Intermediate | 241 | 76.30% | 22.00% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 57.30% | 40.60% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 54.40% | 11.10% | 5.56% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403407500 | A -> DEL | N | N | silent_mutation | Average:27.468; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0403407500 | A -> T | LOC_Os04g06490.1 | upstream_gene_variant ; 1869.0bp to feature; MODIFIER | silent_mutation | Average:27.468; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0403407500 | A -> T | LOC_Os04g06530.1 | downstream_gene_variant ; 98.0bp to feature; MODIFIER | silent_mutation | Average:27.468; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0403407500 | A -> T | LOC_Os04g06520.1 | downstream_gene_variant ; 3228.0bp to feature; MODIFIER | silent_mutation | Average:27.468; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| vg0403407500 | A -> T | LOC_Os04g06490-LOC_Os04g06530 | intergenic_region ; MODIFIER | silent_mutation | Average:27.468; most accessible tissue: Minghui63 flag leaf, score: 51.386 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403407500 | 2.31E-06 | NA | mr1364_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |