\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0403406131:

Variant ID: vg0403406131 (JBrowse)Variation Type: SNP
Chromosome: chr04Position: 3406131
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTTTCCAATATACTCTGTGAAATATCACTAGAATTACAATATTATAAAAAGATGATTGTAAAAGTAGTTAAACATATTTTACCAGCTCCTATAATCTCT[A/T]
CCTCCCAATGAAAAGTTTAAAAATATTTACGTGTTGTTTGGTGATAAACATGTTTTATGGTCAAAGCAAATTTCTTTGTATTATATAATCCCTTAATTTC

Reverse complement sequence

GAAATTAAGGGATTATATAATACAAAGAAATTTGCTTTGACCATAAAACATGTTTATCACCAAACAACACGTAAATATTTTTAAACTTTTCATTGGGAGG[T/A]
AGAGATTATAGGAGCTGGTAAAATATGTTTAACTACTTTTACAATCATCTTTTTATAATATTGTAATTCTAGTGATATTTCACAGAGTATATTGGAAAGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.50% 13.80% 9.46% 5.21% NA
All Indica  2759 58.30% 23.30% 15.44% 2.90% NA
All Japonica  1512 97.20% 0.10% 0.46% 2.25% NA
Aus  269 67.70% 0.00% 0.37% 31.97% NA
Indica I  595 19.20% 42.00% 36.30% 2.52% NA
Indica II  465 60.20% 23.70% 15.05% 1.08% NA
Indica III  913 79.60% 13.30% 3.29% 3.83% NA
Indica Intermediate  786 62.10% 20.70% 13.99% 3.18% NA
Temperate Japonica  767 99.20% 0.00% 0.65% 0.13% NA
Tropical Japonica  504 93.70% 0.20% 0.20% 5.95% NA
Japonica Intermediate  241 97.90% 0.40% 0.41% 1.24% NA
VI/Aromatic  96 56.20% 0.00% 2.08% 41.67% NA
Intermediate  90 72.20% 8.90% 12.22% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0403406131 A -> DEL N N silent_mutation Average:24.385; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0403406131 A -> T LOC_Os04g06490.1 upstream_gene_variant ; 500.0bp to feature; MODIFIER silent_mutation Average:24.385; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0403406131 A -> T LOC_Os04g06530.1 downstream_gene_variant ; 1467.0bp to feature; MODIFIER silent_mutation Average:24.385; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0403406131 A -> T LOC_Os04g06520.1 downstream_gene_variant ; 4597.0bp to feature; MODIFIER silent_mutation Average:24.385; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N
vg0403406131 A -> T LOC_Os04g06490-LOC_Os04g06530 intergenic_region ; MODIFIER silent_mutation Average:24.385; most accessible tissue: Minghui63 panicle, score: 46.754 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0403406131 NA 3.47E-06 mr1217 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403406131 1.85E-06 1.85E-06 mr1845 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251