\
| Variant ID: vg0403275601 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3275601 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GACTTGTGGAATGTGAAATGCATGTGATATTGCAATCATTTGTGGAATGTTAATTCATTTGAATTTGATTTTATATGTGCTGAAATATTGTATTTGGGCT[G/A]
AATTGTATGGGCTGAAAAAATTTCAGTTGAGTTTTGTGGGCTGAAAAAATTATATGGGCTAAACTGTGGGGGCTAAAAAAATCATATGGGCTGAATTGTG
CACAATTCAGCCCATATGATTTTTTTAGCCCCCACAGTTTAGCCCATATAATTTTTTCAGCCCACAAAACTCAACTGAAATTTTTTCAGCCCATACAATT[C/T]
AGCCCAAATACAATATTTCAGCACATATAAAATCAAATTCAAATGAATTAACATTCCACAAATGATTGCAATATCACATGCATTTCACATTCCACAAGTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.50% | 1.80% | 18.30% | 32.42% | NA |
| All Indica | 2759 | 45.00% | 2.70% | 25.01% | 27.29% | NA |
| All Japonica | 1512 | 53.80% | 0.30% | 3.31% | 42.59% | NA |
| Aus | 269 | 48.70% | 1.10% | 31.23% | 18.96% | NA |
| Indica I | 595 | 63.90% | 0.00% | 22.02% | 14.12% | NA |
| Indica II | 465 | 44.30% | 0.00% | 32.04% | 23.66% | NA |
| Indica III | 913 | 31.10% | 7.00% | 21.69% | 40.20% | NA |
| Indica Intermediate | 786 | 47.20% | 1.40% | 26.97% | 24.43% | NA |
| Temperate Japonica | 767 | 84.90% | 0.00% | 2.48% | 12.65% | NA |
| Tropical Japonica | 504 | 16.50% | 0.80% | 4.76% | 77.98% | NA |
| Japonica Intermediate | 241 | 33.20% | 0.00% | 2.90% | 63.90% | NA |
| VI/Aromatic | 96 | 15.60% | 0.00% | 21.88% | 62.50% | NA |
| Intermediate | 90 | 46.70% | 4.40% | 22.22% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403275601 | G -> DEL | N | N | silent_mutation | Average:28.068; most accessible tissue: Callus, score: 75.156 | N | N | N | N |
| vg0403275601 | G -> A | LOC_Os04g06280.1 | intron_variant ; MODIFIER | silent_mutation | Average:28.068; most accessible tissue: Callus, score: 75.156 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403275601 | NA | 7.16E-20 | mr1077 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403275601 | NA | 1.91E-08 | mr1770 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403275601 | NA | 3.35E-07 | mr1798 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403275601 | 4.90E-06 | 4.90E-06 | mr1828 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403275601 | NA | 2.54E-06 | mr1277_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403275601 | NA | 7.62E-07 | mr1798_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |