Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0403256148:

Variant ID: vg0403256148 (JBrowse)	Variation Type: SNP
Chromosome: chr04	Position: 3256148
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.24, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

AATATTTGCTTCATCCTTAAAACCACAATGGTAGTTTAAATTTGGGATGATGGGAGTATAGAAGATAGAGCACGCCGAGCGAGCCGGCGTTACTTTTAGC[T/C]
GATCGACTTTTATTATTTTCTTCCTTTTAGATTAGTTTTATCCGATAATGCTATTATTAGTAGCCTGAATCTATCAAAACATGGCAGCAATGATTGCTCA

Reverse complement sequence

TGAGCAATCATTGCTGCCATGTTTTGATAGATTCAGGCTACTAATAATAGCATTATCGGATAAAACTAATCTAAAAGGAAGAAAATAATAAAAGTCGATC[A/G]
GCTAAAAGTAACGCCGGCTCGCTCGGCGTGCTCTATCTTCTATACTCCCATCATCCCAAATTTAAACTACCATTGTGGTTTTAAGGATGAAGCAAATATT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.50%	23.50%	3.41%	2.56%	NA
All Indica	2759	81.80%	13.30%	2.50%	2.36%	NA
All Japonica	1512	45.90%	46.20%	5.42%	2.51%	NA
Aus	269	84.00%	8.60%	1.86%	5.58%	NA
Indica I	595	64.70%	28.90%	6.05%	0.34%	NA
Indica II	465	81.50%	12.90%	1.29%	4.30%	NA
Indica III	913	94.90%	2.00%	0.55%	2.63%	NA
Indica Intermediate	786	79.80%	15.00%	2.80%	2.42%	NA
Temperate Japonica	767	16.70%	75.70%	5.35%	2.22%	NA
Tropical Japonica	504	82.30%	10.90%	4.17%	2.58%	NA
Japonica Intermediate	241	62.70%	25.70%	8.30%	3.32%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	72.20%	18.90%	5.56%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0403256148	T -> C	LOC_Os04g06260.1	upstream_gene_variant ; 1653.0bp to feature; MODIFIER	silent_mutation	Average:14.55; most accessible tissue: Callus, score: 43.464	N	N	N	N
vg0403256148	T -> C	LOC_Os04g06244-LOC_Os04g06260	intergenic_region ; MODIFIER	silent_mutation	Average:14.55; most accessible tissue: Callus, score: 43.464	N	N	N	N
vg0403256148	T -> DEL	N	N	silent_mutation	Average:14.55; most accessible tissue: Callus, score: 43.464	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0403256148	NA	7.20E-10	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0403256148	NA	3.70E-13	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0403256148	NA	1.66E-13	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0403256148	NA	1.27E-12	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0403256148	NA	7.44E-08	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403256148	NA	6.66E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403256148	NA	4.25E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403256148	NA	5.81E-07	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403256148	NA	4.52E-06	mr1851	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403256148	6.33E-06	NA	mr1864	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403256148	NA	1.73E-12	mr1864	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403256148	NA	4.96E-20	mr1010_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403256148	NA	1.97E-08	mr1521_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0403256148	NA	6.06E-09	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251