\
| Variant ID: vg0403256148 (JBrowse) | Variation Type: SNP |
| Chromosome: chr04 | Position: 3256148 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.76, C: 0.24, others allele: 0.00, population size: 41. )
AATATTTGCTTCATCCTTAAAACCACAATGGTAGTTTAAATTTGGGATGATGGGAGTATAGAAGATAGAGCACGCCGAGCGAGCCGGCGTTACTTTTAGC[T/C]
GATCGACTTTTATTATTTTCTTCCTTTTAGATTAGTTTTATCCGATAATGCTATTATTAGTAGCCTGAATCTATCAAAACATGGCAGCAATGATTGCTCA
TGAGCAATCATTGCTGCCATGTTTTGATAGATTCAGGCTACTAATAATAGCATTATCGGATAAAACTAATCTAAAAGGAAGAAAATAATAAAAGTCGATC[A/G]
GCTAAAAGTAACGCCGGCTCGCTCGGCGTGCTCTATCTTCTATACTCCCATCATCCCAAATTTAAACTACCATTGTGGTTTTAAGGATGAAGCAAATATT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 70.50% | 23.50% | 3.41% | 2.56% | NA |
| All Indica | 2759 | 81.80% | 13.30% | 2.50% | 2.36% | NA |
| All Japonica | 1512 | 45.90% | 46.20% | 5.42% | 2.51% | NA |
| Aus | 269 | 84.00% | 8.60% | 1.86% | 5.58% | NA |
| Indica I | 595 | 64.70% | 28.90% | 6.05% | 0.34% | NA |
| Indica II | 465 | 81.50% | 12.90% | 1.29% | 4.30% | NA |
| Indica III | 913 | 94.90% | 2.00% | 0.55% | 2.63% | NA |
| Indica Intermediate | 786 | 79.80% | 15.00% | 2.80% | 2.42% | NA |
| Temperate Japonica | 767 | 16.70% | 75.70% | 5.35% | 2.22% | NA |
| Tropical Japonica | 504 | 82.30% | 10.90% | 4.17% | 2.58% | NA |
| Japonica Intermediate | 241 | 62.70% | 25.70% | 8.30% | 3.32% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 18.90% | 5.56% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0403256148 | T -> C | LOC_Os04g06260.1 | upstream_gene_variant ; 1653.0bp to feature; MODIFIER | silent_mutation | Average:14.55; most accessible tissue: Callus, score: 43.464 | N | N | N | N |
| vg0403256148 | T -> C | LOC_Os04g06244-LOC_Os04g06260 | intergenic_region ; MODIFIER | silent_mutation | Average:14.55; most accessible tissue: Callus, score: 43.464 | N | N | N | N |
| vg0403256148 | T -> DEL | N | N | silent_mutation | Average:14.55; most accessible tissue: Callus, score: 43.464 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0403256148 | NA | 7.20E-10 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0403256148 | NA | 3.70E-13 | Plant_height | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0403256148 | NA | 1.66E-13 | Spikelet_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0403256148 | NA | 1.27E-12 | Spikelet_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0403256148 | NA | 7.44E-08 | mr1252 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403256148 | NA | 6.66E-06 | mr1521 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403256148 | NA | 4.25E-06 | mr1576 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403256148 | NA | 5.81E-07 | mr1729 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403256148 | NA | 4.52E-06 | mr1851 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403256148 | 6.33E-06 | NA | mr1864 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403256148 | NA | 1.73E-12 | mr1864 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403256148 | NA | 4.96E-20 | mr1010_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403256148 | NA | 1.97E-08 | mr1521_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0403256148 | NA | 6.06E-09 | mr1576_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |